General Information of the Molecule (ID: Mol01693)
Name
hsa-miR-660-5p ,Homo sapiens
Synonyms
microRNA 660
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UACCCAUUGCAUAUCGGAGUUG
    Click to Show/Hide
Ensembl ID
ENSG00000207970
HGNC ID
HGNC:32916
Mature Accession
MIMAT0003338
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
Click to Show/Hide the Full List of Drugs
Dasatinib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Chronic myeloid leukemia [1]
Resistant Disease Chronic myeloid leukemia [ICD-11: 2A20.0]
Resistant Drug Dasatinib
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model Lin-CD34+CD38- cells Bone Homo sapiens (Human) N.A.
Lin-CD34-CD38- CML cells Bone Homo sapiens (Human) N.A.
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Annexin V assay
Mechanism Description The up-regulation of miR660-5p observed in CML LSCs led to the down-regulation of its target EPAS1 and conferred TkI-resistance to CML LSCs in vitro.
Imatinib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Chronic myeloid leukemia [1]
Resistant Disease Chronic myeloid leukemia [ICD-11: 2A20.0]
Resistant Drug Imatinib
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model Lin-CD34+CD38- cells Bone Homo sapiens (Human) N.A.
Lin-CD34-CD38- CML cells Bone Homo sapiens (Human) N.A.
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Annexin V assay
Mechanism Description The up-regulation of miR660-5p observed in CML LSCs led to the down-regulation of its target EPAS1 and conferred TkI-resistance to CML LSCs in vitro.
Ponatinib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Chronic myeloid leukemia [1]
Resistant Disease Chronic myeloid leukemia [ICD-11: 2A20.0]
Resistant Drug Ponatinib
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model Lin-CD34+CD38- cells Bone Homo sapiens (Human) N.A.
Lin-CD34-CD38- CML cells Bone Homo sapiens (Human) N.A.
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Annexin V assay
Mechanism Description The up-regulation of miR660-5p observed in CML LSCs led to the down-regulation of its target EPAS1 and conferred TkI-resistance to CML LSCs in vitro.
References
Ref 1 Deregulated expression of miR-29a-3p, miR-494-3p and miR-660-5p affects sensitivity to tyrosine kinase inhibitors in CML leukemic stem cells. Oncotarget. 2017 Jul 25;8(30):49451-49469. doi: 10.18632/oncotarget.17706.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.