Molecule Information
General Information of the Molecule (ID: Mol01693)
Name |
hsa-miR-660-5p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 660
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
UACCCAUUGCAUAUCGGAGUUG
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
Dasatinib
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
Epigenetic Alteration of DNA, RNA or Protein (EADR) | ||||
Disease Class: Chronic myeloid leukemia | [1] | |||
Resistant Disease | Chronic myeloid leukemia [ICD-11: 2A20.0] | |||
Resistant Drug | Dasatinib | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
In Vitro Model | Lin-CD34+CD38- cells | Bone | Homo sapiens (Human) | N.A. |
Lin-CD34-CD38- CML cells | Bone | Homo sapiens (Human) | N.A. | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Annexin V assay | |||
Mechanism Description | The up-regulation of miR660-5p observed in CML LSCs led to the down-regulation of its target EPAS1 and conferred TkI-resistance to CML LSCs in vitro. |
Imatinib
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
Epigenetic Alteration of DNA, RNA or Protein (EADR) | ||||
Disease Class: Chronic myeloid leukemia | [1] | |||
Resistant Disease | Chronic myeloid leukemia [ICD-11: 2A20.0] | |||
Resistant Drug | Imatinib | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
In Vitro Model | Lin-CD34+CD38- cells | Bone | Homo sapiens (Human) | N.A. |
Lin-CD34-CD38- CML cells | Bone | Homo sapiens (Human) | N.A. | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Annexin V assay | |||
Mechanism Description | The up-regulation of miR660-5p observed in CML LSCs led to the down-regulation of its target EPAS1 and conferred TkI-resistance to CML LSCs in vitro. |
Ponatinib
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
Epigenetic Alteration of DNA, RNA or Protein (EADR) | ||||
Disease Class: Chronic myeloid leukemia | [1] | |||
Resistant Disease | Chronic myeloid leukemia [ICD-11: 2A20.0] | |||
Resistant Drug | Ponatinib | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
In Vitro Model | Lin-CD34+CD38- cells | Bone | Homo sapiens (Human) | N.A. |
Lin-CD34-CD38- CML cells | Bone | Homo sapiens (Human) | N.A. | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Annexin V assay | |||
Mechanism Description | The up-regulation of miR660-5p observed in CML LSCs led to the down-regulation of its target EPAS1 and conferred TkI-resistance to CML LSCs in vitro. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.