Molecule Information

General Information of the Molecule (ID: Mol01691)

• Name: hsa-miR-663a ,Homo sapiens
• Synonyms: microRNA 663a
• Molecule Type: Mature miRNA
• Sequence: AGGCGGGGCGCCGCGGGACCGC
• Ensembl ID: ENSG00000284419
• HGNC ID: HGNC:32919
• Mature Accession: MIMAT0003326

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Gemcitabine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic ductal adenocarcinoma [1]

• Sensitive Disease: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: BxPC-3 cells; Pancreas; Homo sapiens (Human); CVCL_0186
• In Vitro Model: MIA PaCa-2 cells; Pancreas; Homo sapiens (Human); CVCL_0428
• In Vitro Model: PANC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• In Vitro Model: T3-M4 cells; Pancreas; Homo sapiens (Human); CVCL_VQ95
• Experiment for Molecule Alteration: RT-PCR, qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Colony formation assay; Flow cytometry assay
• Mechanism Description: Upregulated miR-663 expression in PDAC cell lines promotes sensitivity to GEM.

Clinical Trial Drug(s) 1 drug(s) in total

OSI-027

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic ductal adenocarcinoma [1]

• Sensitive Disease: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
• Sensitive Drug: OSI-027
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: BxPC-3 cells; Pancreas; Homo sapiens (Human); CVCL_0186
• In Vitro Model: MIA PaCa-2 cells; Pancreas; Homo sapiens (Human); CVCL_0428
• In Vitro Model: PANC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• In Vitro Model: T3-M4 cells; Pancreas; Homo sapiens (Human); CVCL_VQ95
• Experiment for Molecule Alteration: RT-PCR, qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Colony formation assay; Flow cytometry assay
• Mechanism Description: Gemcitabine enhances OSI-027 cytotoxicity by upregulation of miR-663a in pancreatic ductal adenocarcinoma cells.

References

• Ref 1: Gemcitabine enhances OSI-027 cytotoxicity by upregulation of miR-663a in pancreatic ductal adenocarcinoma cells. Am J Transl Res. 2019 Jan 15;11(1):473-485. eCollection 2019.