Molecule Information

General Information of the Molecule (ID: Mol01689)

• Name: hsa-miR-650 ,Homo sapiens
• Synonyms: microRNA 650
• Molecule Type: Mature miRNA
• Sequence: AGGAGGCAGCGCUCUCAGGAC
• Ensembl ID: ENSG00000284049
• HGNC ID: HGNC:32906
• Mature Accession: MIMAT0003320

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Docetaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung adenocarcinoma [1]

• Sensitive Disease: Lung adenocarcinoma [ICD-11: 2C25.0]
• Sensitive Drug: Docetaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell colony; Inhibition; hsa05200
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: SPC-A1 cells; Lung; Homo sapiens (Human); CVCL_6955
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-650 could contribute to docetaxel chemoresistance of LAD cells by post-transcriptionally downregulating ING4.

References

• Ref 1: MicroRNA-650 was a prognostic factor in human lung adenocarcinoma and confers the docetaxel chemoresistance of lung adenocarcinoma cells via regulating Bcl-2/Bax expression. PLoS One. 2013 Aug 21;8(8):e72615. doi: 10.1371/journal.pone.0072615. eCollection 2013.