Molecule Information

General Information of the Molecule (ID: Mol01688)

• Name: hsa-miR-647 ,Homo sapiens
• Synonyms: microRNA 647
• Molecule Type: Mature miRNA
• Sequence: GUGGCUGCACUCACUUCCUUC
• Ensembl ID: ENSG00000207554
• HGNC ID: HGNC:32903
• Mature Accession: MIMAT0003317

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Vincristine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [1]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• In Vitro Model: GES-1 cells; Gastric; Homo sapiens (Human); CVCL_EQ22
• In Vitro Model: SGC7901/VCR cells; Gastric; Homo sapiens (Human); CVCL_VU58
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: Flow cytometry assay; Wound healing and transwell assay
• Mechanism Description: Overexpression of miR647 sensitizes tumors to chemotherapy in vivo by reducing the expression levels of ANk2, FAk, MMP2, MMP12, CD44 and SNAIL1.

References

• Ref 1: Regulation of drug resistance and metastasis of gastric cancer cells via the microRNA647-ANK2 axis. Int J Mol Med. 2018 Apr;41(4):1958-1966. doi: 10.3892/ijmm.2018.3381. Epub 2018 Jan 11.