Molecule Information

General Information of the Molecule (ID: Mol01685)

• Name: hsa-miR-638 ,Homo sapiens
• Synonyms: microRNA 638
• Molecule Type: Mature miRNA
• Sequence: AGGGAUCGCGGGCGGGUGGCGGCCU
• Ensembl ID: ENSG00000207972
• HGNC ID: HGNC:32894
• Mature Accession: MIMAT0003308

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [1]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: DNA damage repair signaling pathway; Inhibition; hsa03410
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: Hs-578T cells; Breast; Homo sapiens (Human); CVCL_0332
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Matrigel invasion assay
• Mechanism Description: miR-638 overexpression increased sensitivity to DNA-damaging agents, ultraviolet (UV) and cisplatin.

Docetaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [2]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Docetaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: STARD10 signaling pathway; Inhibition; hsa05206
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: MDA-MB-468 cells; Breast; Homo sapiens (Human); CVCL_0419
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: ELISA; MTT assay; Transwell invasion assay
• Mechanism Description: Acquired resistance to DTX is caused by the miR638 deficiency and subsequent STARD10 upregulation.

References

• Ref 1: miR-638 mediated regulation of BRCA1 affects DNA repair and sensitivity to UV and cisplatin in triple-negative breast cancer. Breast Cancer Res. 2014 Sep 17;16(5):435. doi: 10.1186/s13058-014-0435-5.
• Ref 2: Potentiation of docetaxel sensitivity by miR-638 via regulation of STARD10 pathway in human breast cancer cells. Biochem Biophys Res Commun. 2017 May 27;487(2):255-261. doi: 10.1016/j.bbrc.2017.04.045. Epub 2017 Apr 12.