Molecule Information

General Information of the Molecule (ID: Mol01682)

Name	hsa-miR-33b-5p ,Homo sapiens
Synonyms	microRNA 33b Click to Show/Hide
Molecule Type	Mature miRNA
Sequence	GUGCAUUGCUGUUGCAUUGC Click to Show/Hide
Ensembl ID	ENSG00000207839
HGNC ID	HGNC:32791
Mature Accession	MIMAT0003301
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

2 drug(s) in total

Click to Show/Hide the Full List of Drugs

Cisplatin

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Gastric cancer				[1]
Sensitive Disease	Gastric cancer [ICD-11: 2B72.1]			Disease Info
Sensitive Drug	Cisplatin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	MGC-803 cells	Gastric	Homo sapiens (Human)	CVCL_5334
	SGC7901 cells	Gastric	Homo sapiens (Human)	CVCL_0520
	GES-1 cells	Gastric	Homo sapiens (Human)	CVCL_EQ22
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	CCK8 assay; Colony formation assay; Flow cytometric apoptosis assay
Mechanism Description	miR33b-5p sensitizes gastric cancer cells to chemotherapy drugs via inhibiting HMGA2 expression.

Docetaxel

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Gastric cancer				[1]
Sensitive Disease	Gastric cancer [ICD-11: 2B72.1]			Disease Info
Sensitive Drug	Docetaxel			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	MGC-803 cells	Gastric	Homo sapiens (Human)	CVCL_5334
	SGC7901 cells	Gastric	Homo sapiens (Human)	CVCL_0520
	GES-1 cells	Gastric	Homo sapiens (Human)	CVCL_EQ22
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	CCK8 assay; Colony formation assay; Flow cytometric apoptosis assay
Mechanism Description	miR33b-5p sensitizes gastric cancer cells to chemotherapy drugs via inhibiting HMGA2 expression.

References

Ref 1	MiR-33b-5p sensitizes gastric cancer cells to chemotherapy drugs via inhibiting HMGA2 expression. J Drug Target. 2017 Aug;25(7):653-660. doi: 10.1080/1061186X.2017.1323220. Epub 2017 May 11.