Molecule Information

General Information of the Molecule (ID: Mol01678)

• Name: hsa-miR-620 ,Homo sapiens
• Synonyms: microRNA 620
• Molecule Type: Mature miRNA
• Sequence: AUGGAGAUAGAUAUAGAAAU
• Ensembl ID: ENSG00000207967
• HGNC ID: HGNC:32876
• Mature Accession: MIMAT0003289

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Triple negative breast cancer [1]

• Resistant Disease: Triple negative breast cancer [ICD-11: 2C60.9]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: Overexpression of microRNA-620 facilitates the resistance of triple negative breast cancer cells to gemcitabine treatment by targeting DCTD.

References

• Ref 1: Overexpression of microRNA-620 facilitates the resistance of triple negative breast cancer cells to gemcitabine treatment by targeting DCTD. Exp Ther Med. 2019 Jul;18(1):550-558. doi: 10.3892/etm.2019.7601. Epub 2019 May 23.