Molecule Information

General Information of the Molecule (ID: Mol01677)
Name
hsa-miR-613 ,Homo sapiens
Synonyms
microRNA 613
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
AGGAAUGUUCCUUCUUUGCC
    Click to Show/Hide
Ensembl ID
ENSG00000207983
HGNC ID
HGNC:32869
Mature Accession
MIMAT0003281
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Liver cancer [1]
Resistant Disease Liver cancer [ICD-11: 2C12.6]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
SOX9 signaling pathway Activation hsa04024
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
HCCLM3 cells Liver Homo sapiens (Human) CVCL_6832
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 CCK8 assay; Flow cytometry assay
Mechanism Description The drug sensitivity of HCC to sorafenib and cisplatin was significantly decreased when miR-613 was knockdown, suggesting that miR-613 played a possible role in the treatment of HCC drug resistance.
Disease Class: Gastric cancer [2]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Activation hsa05200
Cell migration Activation hsa04670
Cell viability Activation hsa05200
In Vitro Model MGC-803 cells Gastric Homo sapiens (Human) CVCL_5334
SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
HGC27 cells Gastric Homo sapiens (Human) CVCL_1279
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay; Wound healing assay
Mechanism Description Elevated expression of miR-613 increased the sensitivity of GC cells to cisplatin and suppressed GC cell proliferation and migration by targeting SOX9.
Sorafenib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Liver cancer [1]
Resistant Disease Liver cancer [ICD-11: 2C12.6]
 Disease Info 
Resistant Drug Sorafenib
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
SOX9 signaling pathway Activation hsa04024
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
HCCLM3 cells Liver Homo sapiens (Human) CVCL_6832
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 CCK8 assay; Flow cytometry assay
Mechanism Description The drug sensitivity of HCC to sorafenib and cisplatin was significantly decreased when miR-613 was knockdown, suggesting that miR-613 played a possible role in the treatment of HCC drug resistance.
References
Ref 1 miR-613 inhibits liver cancer stem cell expansion by regulating SOX9 pathway. Gene. 2019 Jul 30;707:78-85. doi: 10.1016/j.gene.2019.05.015. Epub 2019 May 7.
Ref 2 MicroRNA-613 induces the sensitivity of gastric cancer cells to cisplatin through targeting SOX9 expression. Am J Transl Res. 2019 Feb 15;11(2):885-894. eCollection 2019.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.