Molecule Information

General Information of the Molecule (ID: Mol01676)

• Name: hsa-miR-595 ,Homo sapiens
• Synonyms: microRNA 595
• Molecule Type: Mature miRNA
• Sequence: GAAGUGUGCCGUGGUGUGUCU
• Ensembl ID: ENSG00000207637
• HGNC ID: HGNC:32851
• Mature Accession: MIMAT0003263

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [1]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: HO8910 cells; Ovary; Homo sapiens (Human); CVCL_6868
• In Vitro Model: ES2 cells; Ovary; Homo sapiens (Human); CVCL_AX39
• In Vitro Model: FTE187 cells; Ovary; Homo sapiens (Human); N.A.
• In Vitro Model: HG-SOC cells; Ovary; Homo sapiens (Human); N.A.
• In Vitro Model: HO8910PM cells; Ovary; Homo sapiens (Human); CVCL_0310
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: microRNA-595 sensitizes ovarian cancer cells to cisplatin by targeting ABCB1. The expression level of ABCB1 was inversely correlated with miR595 in the ovarian cancer tissues, overexpression of ABCB1 decreased the miR595-overexpressing HO8910PM and SkOV-3 cell sensitivity to cisplatin.

References

• Ref 1: MicroRNA-595 sensitizes ovarian cancer cells to cisplatin by targeting ABCB1. Oncotarget. 2016 Dec 27;7(52):87091-87099. doi: 10.18632/oncotarget.13526.