Molecule Information

General Information of the Molecule (ID: Mol01674)

• Name: hsa-miR-590-5p ,Homo sapiens
• Synonyms: microRNA 590
• Molecule Type: Mature miRNA
• Sequence: GAGCUUAUUCAUAAAAGUGCAG
• Ensembl ID: ENSG00000207741
• HGNC ID: HGNC:32846
• Mature Accession: MIMAT0003258

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [1]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: AKT/ERK signaling pathway; Activation; hsa04010
• In Vitro Model: BGC-823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• In Vitro Model: MGC-803 cells; Gastric; Homo sapiens (Human); CVCL_5334
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: AGS cells; Gastric; Homo sapiens (Human); CVCL_0139
• In Vitro Model: MkN-45 cells; Gastric; Homo sapiens (Human); CVCL_0434
• In Vitro Model: MkN28 cells; Gastric; Homo sapiens (Human); CVCL_1416
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay; Matrigel transwell assay
• Mechanism Description: miR590-5p regulates gastric cancer cell growth and chemosensitivity through RECk and the AkT/ERk pathway. RECk is a direct target of miR590-5p, knockdown of RECk accelerated cell proliferation and motility and decreased the drug sensitivity.The AkT/ERk and STAT3 signaling pathways were activated by miR590-5p overexpression.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [2]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• Cell Pathway Regulation: Hippo signaling pathway; Regulation; hsa04392
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vivo Model: NU/NU nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-590-5p suppresses hepatocellular carcinoma chemoresistance by downregulating YAP1 expression.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [1]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: AKT/ERK signaling pathway; Activation; hsa04010
• In Vitro Model: BGC-823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• In Vitro Model: MGC-803 cells; Gastric; Homo sapiens (Human); CVCL_5334
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: AGS cells; Gastric; Homo sapiens (Human); CVCL_0139
• In Vitro Model: MkN-45 cells; Gastric; Homo sapiens (Human); CVCL_0434
• In Vitro Model: MkN28 cells; Gastric; Homo sapiens (Human); CVCL_1416
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay; Matrigel transwell assay
• Mechanism Description: miR590-5p regulates gastric cancer cell growth and chemosensitivity through RECk and the AkT/ERk pathway. RECk is a direct target of miR590-5p, knockdown of RECk accelerated cell proliferation and motility and decreased the drug sensitivity.The AkT/ERk and STAT3 signaling pathways were activated by miR590-5p overexpression.

References

• Ref 1: miR-590-5p regulates gastric cancer cell growth and chemosensitivity through RECK and the AKT/ERK pathway. Onco Targets Ther. 2016 Oct 3;9:6009-6019. doi: 10.2147/OTT.S110923. eCollection 2016.
• Ref 2: miR-590-5p suppresses hepatocellular carcinoma chemoresistance by targeting YAP1 expression. EBioMedicine. 2018 Sep;35:142-154. doi: 10.1016/j.ebiom.2018.08.010. Epub 2018 Aug 13.