Molecule Information

General Information of the Molecule (ID: Mol01673)

• Name: hsa-miR-587 ,Homo sapiens
• Synonyms: microRNA 587
• Molecule Type: Mature miRNA
• Sequence: UUUCCAUAGGUGAUGAGUCAC
• Ensembl ID: ENSG00000207577
• HGNC ID: HGNC:32843
• Mature Accession: MIMAT0003253

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [1]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: miR587/PPP2R1B/pAKT/XIAP signaling pathway; Inhibition; hsa05206
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: RkO cells; Colon; Homo sapiens (Human); CVCL_0504
• In Vitro Model: FET cells; Colon; Homo sapiens (Human); CVCL_A604
• In Vitro Model: GEO cells; Colon; Homo sapiens (Human); CVCL_0271
• Experiment for Molecule Alteration: RT-PCR; RT-qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: microRNA-587 antagonizes 5-FU-induced apoptosis and confers drug resistance by inhibiting PPP2R1B expression in colorectal cancer.

References

• Ref 1: MicroRNA-587 antagonizes 5-FU-induced apoptosis and confers drug resistance by regulating PPP2R1B expression in colorectal cancer. Cell Death Dis. 2015 Aug 6;6(8):e1845. doi: 10.1038/cddis.2015.200.