Molecule Information

General Information of the Molecule (ID: Mol01672)

• Name: hsa-miR-582-5p ,Homo sapiens
• Synonyms: microRNA 582
• Molecule Type: Mature miRNA
• Sequence: UUACAGUUGUUCAACCAGUUACU
• Ensembl ID: ENSG00000202601
• HGNC ID: HGNC:32838
• Mature Accession: MIMAT0003247

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Sirolimus

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Bladder cancer [1]

• Resistant Disease: Bladder cancer [ICD-11: 2C94.0]
• Resistant Drug: Sirolimus
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: 5637 cells; Bladder; Homo sapiens (Human); CVCL_0126
• In Vitro Model: EJ cells; Bladder; Homo sapiens (Human); CVCL_UI82
• In Vitro Model: J82 cells; Bladder; Homo sapiens (Human); CVCL_0359
• In Vitro Model: SV-HUC-1 cells; Bladder; Homo sapiens (Human); CVCL_3798
• In Vitro Model: T24 cells; Bladder; Homo sapiens (Human); CVCL_0554
• In Vitro Model: HT1376 cells; Bladder; Homo sapiens (Human); CVCL_1292
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: UCA1 knockdown suppresses growth, migration, and invasion of T24 and 5637 cells via derepression of miR-582-5p and ATG7 was downregulated by UCA1 shRNA and upregulated by miR-582-5p inhibitor.

References

• Ref 1: Long noncoding RNA UCA1 targets miR-582-5p and contributes to the progression and drug resistance of bladder cancer cells through ATG7-mediated autophagy inhibition. Onco Targets Ther. 2019 Jan 9;12:495-508. doi: 10.2147/OTT.S183940. eCollection 2019.