Molecule Information

General Information of the Molecule (ID: Mol01670)

Name	hsa-miR-574-3p ,Homo sapiens
Synonyms	microRNA 574 Click to Show/Hide
Molecule Type	Mature miRNA
Sequence	CACGCUCAUGCACACACCCACA Click to Show/Hide
Ensembl ID	ENSG00000207944
HGNC ID	HGNC:32830
Mature Accession	MIMAT0003239
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

2 drug(s) in total

Click to Show/Hide the Full List of Drugs

Cisplatin

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Gastric carcinoma				[1]
Sensitive Disease	Gastric carcinoma [ICD-11: 2B72.Z]			Disease Info
Sensitive Drug	Cisplatin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell invasion		Inhibition	hsa05200
	Cell migration		Inhibition	hsa04670
	Cell proliferation		Inhibition	hsa05200
In Vitro Model	SGC7901 cells	Gastric	Homo sapiens (Human)	CVCL_0520
Experiment for Molecule Alteration	qPCR
Experiment for Drug Resistance	MTT assay
Mechanism Description	microRNA-574-3p regulates epithelial mesenchymal transition and cisplatin resistance via targeting ZEB1 in human gastric carcinoma cells.

Tamoxifen

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Breast cancer				[2]
Sensitive Disease	Breast cancer [ICD-11: 2C60.3]			Disease Info
Sensitive Drug	Tamoxifen			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Identified from the Human Clinical Data
Cell Pathway Regulation	Cell proliferation		Inhibition	hsa05200
In Vitro Model	MCF-7 cells	Breast	Homo sapiens (Human)	CVCL_0031
	T47D cells	Breast	Homo sapiens (Human)	CVCL_0553
	293T cells	Breast	Homo sapiens (Human)	CVCL_0063
Experiment for Molecule Alteration	qPCR; qRT-PCR
Experiment for Drug Resistance	MTS or WST-8 assay
Mechanism Description	Loss and gain of miR-574-3p function in MCF-7 cells causes CLTC to be upregulated and downregulated, respectively. And CLTC siRNA knockdown restores tamoxifen sensitivity, and low CLTC levels are correlated with better survival in tamoxifen-treated breast cancer patients.

References

Ref 1	MicroRNA-574-3p regulates epithelial mesenchymal transition and cisplatin resistance via targeting ZEB1 in human gastric carcinoma cells. Gene. 2019 Jun 5;700:110-119. doi: 10.1016/j.gene.2019.03.043. Epub 2019 Mar 24.
Ref 2	MicroRNA-574-3p, identified by microRNA library-based functional screening, modulates tamoxifen response in breast cancer. Sci Rep. 2015 Jan 6;5:7641. doi: 10.1038/srep07641.