Molecule Information

General Information of the Molecule (ID: Mol01663)

• Name: hsa-miR-520c-3p ,Homo sapiens
• Synonyms: microRNA 520c
• Molecule Type: Mature miRNA
• Sequence: AAAGUGCUUCCUUUUAGAGGGU
• Ensembl ID: ENSG00000207738
• HGNC ID: HGNC:32108
• Mature Accession: MIMAT0002846

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Acute myeloid leukemia [1]

• Resistant Disease: Acute myeloid leukemia [ICD-11: 2A60.0]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: miR520c-3p/S100A4 signaling pathway; Regulation; hsa05206
• In Vitro Model: THP-1 cells; Blood; Homo sapiens (Human); CVCL_0006
• In Vitro Model: U937 cells; Blood; Homo sapiens (Human); CVCL_0007
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: HOXA-AS2 Can enhance S100A4 expression by suppressing miR-520c-3p expression to promote adriamycin resistance in acute myeloid leukemia through the miR-520c-3p /S100A4 pathway.

References

• Ref 1: Knockdown of Long Noncoding RNA HOXA-AS2 Suppresses Chemoresistance of Acute Myeloid Leukemia via the miR-520c-3p/S100A4 Axis. Cell Physiol Biochem. 2018;51(2):886-896. doi: 10.1159/000495387. Epub 2018 Nov 22.