Molecule Information

General Information of the Molecule (ID: Mol01662)

• Name: hsa-miR-519b-3p ,Homo sapiens
• Synonyms: microRNA 519b
• Molecule Type: Mature miRNA
• Sequence: AAAGUGCAUCCUUUUAGAGGUU
• Ensembl ID: ENSG00000207825
• HGNC ID: HGNC:32101
• Mature Accession: MIMAT0002837

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [1]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: miR-519b-3p mimics promoted HCT116 and SW480 cells more sensitive to chemoradiation treatment while ectopic expression of ARID4B in the meantime decreased the sensitivity.

References

• Ref 1: miR-519b-3p promotes responsiveness to preoperative chemoradiotherapy in rectal cancer patients by targeting ARID4B. Gene. 2018 May 20;655:84-90. doi: 10.1016/j.gene.2018.02.056. Epub 2018 Mar 22.