Molecule Information

General Information of the Molecule (ID: Mol01660)

Name	hsa-miR-494-3p ,Homo sapiens
Synonyms	microRNA 494 Click to Show/Hide
Molecule Type	Mature miRNA
Sequence	UGAAACAUACACGGGAAACCUC Click to Show/Hide
Ensembl ID	ENSG00000194717
HGNC ID	HGNC:32084
Mature Accession	MIMAT0002816
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

3 drug(s) in total

Click to Show/Hide the Full List of Drugs

Dasatinib

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Chronic myeloid leukemia				[1]
Resistant Disease	Chronic myeloid leukemia [ICD-11: 2A20.0]			Disease Info
Resistant Drug	Dasatinib			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Identified from the Human Clinical Data
In Vitro Model	Lin-CD34+CD38- cells	Bone	Homo sapiens (Human)	N.A.
	Lin-CD34-CD38- CML cells	Bone	Homo sapiens (Human)	N.A.
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	Annexin V assay
Mechanism Description	miR494-3p down-regulation in CML LSCs, leading to c-MYC up-regulation, was able to decrease TkI-induced apoptosis.

Imatinib

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Chronic myeloid leukemia				[1]
Resistant Disease	Chronic myeloid leukemia [ICD-11: 2A20.0]			Disease Info
Resistant Drug	Imatinib			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Identified from the Human Clinical Data
In Vitro Model	Lin-CD34+CD38- cells	Bone	Homo sapiens (Human)	N.A.
	Lin-CD34-CD38- CML cells	Bone	Homo sapiens (Human)	N.A.
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	Annexin V assay
Mechanism Description	miR494-3p down-regulation in CML LSCs, leading to c-MYC up-regulation, was able to decrease TkI-induced apoptosis.

Ponatinib

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Chronic myeloid leukemia				[1]
Resistant Disease	Chronic myeloid leukemia [ICD-11: 2A20.0]			Disease Info
Resistant Drug	Ponatinib			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Identified from the Human Clinical Data
In Vitro Model	Lin-CD34+CD38- cells	Bone	Homo sapiens (Human)	N.A.
	Lin-CD34-CD38- CML cells	Bone	Homo sapiens (Human)	N.A.
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	Annexin V assay
Mechanism Description	miR494-3p down-regulation in CML LSCs, leading to c-MYC up-regulation, was able to decrease TkI-induced apoptosis.

References

Ref 1	Deregulated expression of miR-29a-3p, miR-494-3p and miR-660-5p affects sensitivity to tyrosine kinase inhibitors in CML leukemic stem cells. Oncotarget. 2017 Jul 25;8(30):49451-49469. doi: 10.18632/oncotarget.17706.