Molecule Information
General Information of the Molecule (ID: Mol01658)
Name |
hsa-miR-490-3p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 490
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
CAACCUGGAGGACUCCAUGCUG
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Cisplatin
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
Epigenetic Alteration of DNA, RNA or Protein (EADR) | ||||
Disease Class: Ovarian cancer | [1] | |||
Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
OVCAR3 cells | Ovary | Homo sapiens (Human) | CVCL_0465 | |
OVCAR3/CDDP cells | Ovary | Homo sapiens (Human) | CVCL_0465 | |
SkOV3/CDDP cells | Ovary | Homo sapiens (Human) | CVCL_D622 | |
In Vivo Model | Mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR490-3p sensitizes ovarian cancer cells to cisplatin by directly targeting ABCC2. miR490-3p enhances CDDP sensitivity of ovarian cancer cells through downregulating ABCC2 expression. |
Paclitaxel
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
Epigenetic Alteration of DNA, RNA or Protein (EADR) | ||||
Disease Class: Ovarian cancer | [2] | |||
Resistant Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
Resistant Drug | Paclitaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell invasion | Activation | hsa05200 | |
Cell migration | Activation | hsa04670 | ||
Cell proliferation | Activation | hsa05200 | ||
In Vitro Model | A2780 cells | Ovary | Homo sapiens (Human) | CVCL_0134 |
Experiment for Molecule Alteration |
Western blot analysis | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | microRNA 490-3P was involved in the development of drug resistance through regulating MDR1/P-gp and GST-Pi expression in ovarian cancer cells. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.