Molecule Information
General Information of the Molecule (ID: Mol01657)
Name |
hsa-miR-486-5p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 486-1
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
UCCUGUACUGAGCUGCCCCGAG
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Bromocriptine
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
Epigenetic Alteration of DNA, RNA or Protein (EADR) | ||||
Disease Class: Prolactin-secreting adenoma | [1] | |||
Resistant Disease | Prolactin-secreting adenoma [ICD-11: 2F37.Y] | |||
Resistant Drug | Bromocriptine | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
In Vitro Model | KHM-5M cells | Pleural effusion | Homo sapiens (Human) | CVCL_2975 |
Experiment for Molecule Alteration |
Solexa sequencing assay; qRT-PCR | |||
Experiment for Drug Resistance |
Clinical diagnostic evaluation | |||
Mechanism Description | Hsa-mir-93, hsa-mir-17, hsa-mir-22*, hsa-mir-126*, hsa-mir-142-3p, hsa-mir-144*, hsa-mir-486-5p, hsa-mir-451, and hsa-mir-92a were up-regulated and hsa-mir-30a, hsa-mir-382, and hsa-mir-136 were down-regulated in bromocriptine-resistant prolactinomas in comparison with bromocriptine-sensitive prolactinomas. |
Imatinib
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
Epigenetic Alteration of DNA, RNA or Protein (EADR) | ||||
Disease Class: Chronic myeloid leukemia | [2] | |||
Resistant Disease | Chronic myeloid leukemia [ICD-11: 2A20.0] | |||
Resistant Drug | Imatinib | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell proliferation | Activation | hsa05200 | ||
In Vitro Model | TF-1 cells | Bone marrow | Homo sapiens (Human) | CVCL_0559 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Flow cytometry assay | |||
Mechanism Description | miR-486-5p expression contributes to survival of BCR-ABL-transformed cells after imatinib treatment and that inhibition of miR-486-5p enhances the sensitivity of CML progenitors to imatinib-mediated apoptosis. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.