General Information of the Molecule (ID: Mol01657)
Name
hsa-miR-486-5p ,Homo sapiens
Synonyms
microRNA 486-1
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UCCUGUACUGAGCUGCCCCGAG
    Click to Show/Hide
Ensembl ID
ENSG00000274705
HGNC ID
HGNC:32342
Mature Accession
MIMAT0002177
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Click to Show/Hide the Full List of Drugs
Bromocriptine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Prolactin-secreting adenoma [1]
Resistant Disease Prolactin-secreting adenoma [ICD-11: 2F37.Y]
Resistant Drug Bromocriptine
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model KHM-5M cells Pleural effusion Homo sapiens (Human) CVCL_2975
Experiment for
Molecule Alteration
Solexa sequencing assay; qRT-PCR
Experiment for
Drug Resistance
Clinical diagnostic evaluation
Mechanism Description Hsa-mir-93, hsa-mir-17, hsa-mir-22*, hsa-mir-126*, hsa-mir-142-3p, hsa-mir-144*, hsa-mir-486-5p, hsa-mir-451, and hsa-mir-92a were up-regulated and hsa-mir-30a, hsa-mir-382, and hsa-mir-136 were down-regulated in bromocriptine-resistant prolactinomas in comparison with bromocriptine-sensitive prolactinomas.
Imatinib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Chronic myeloid leukemia [2]
Resistant Disease Chronic myeloid leukemia [ICD-11: 2A20.0]
Resistant Drug Imatinib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model TF-1 cells Bone marrow Homo sapiens (Human) CVCL_0559
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description miR-486-5p expression contributes to survival of BCR-ABL-transformed cells after imatinib treatment and that inhibition of miR-486-5p enhances the sensitivity of CML progenitors to imatinib-mediated apoptosis.
References
Ref 1 MicroRNA expression profile of bromocriptine-resistant prolactinomas .Mol Cell Endocrinol. 2014 Sep;395(1-2):10-8. doi: 10.1016/j.mce.2014.07.014. Epub 2014 Jul 23. 10.1016/j.mce.2014.07.014
Ref 2 MicroRNA-486 regulates normal erythropoiesis and enhances growth and modulates drug response in CML progenitors. Blood. 2015 Feb 19;125(8):1302-13. doi: 10.1182/blood-2014-06-581926. Epub 2014 Dec 16.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.