Molecule Information

General Information of the Molecule (ID: Mol01655)

• Name: hsa-miR-485-5p ,Homo sapiens
• Synonyms: microRNA 485
• Molecule Type: Mature miRNA
• Sequence: AGAGGCUGGCCGUGAUGAAUUC
• Ensembl ID: ENSG00000208027
• HGNC ID: HGNC:32067
• Mature Accession: MIMAT0002175

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Tongue squamous cell carcinoma [1]

• Sensitive Disease: Tongue squamous cell carcinoma [ICD-11: 2B62.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: SCC25 cells; Oral; Homo sapiens (Human); CVCL_1682
• In Vitro Model: SCC25-res cells; Tongue; Homo sapiens (Human); CVCL_A5BQ
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; BrdU incorporation assay
• Mechanism Description: Hsa-miR485-5p reverses epithelial to mesenchymal transition and promotes cisplatin-induced cell death by targeting PAk1 in oral tongue squamous cell carcinom. Overexpression of p21 (RAC1) activated kinase 1 (PAk1) induced epithelial to mesenchymal transition (EMT) and significantly promoted the invasion and migration of oral squamous cell carcinoma SCC25 cells.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [2]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: MDA-MB-468 cells; Breast; Homo sapiens (Human); CVCL_0419
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Transwell assay
• Mechanism Description: miR-485-5p suppresses breast cancer progression and enhances chemosensitivity through down-regulation of survivin expression.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [2]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: MDA-MB-468 cells; Breast; Homo sapiens (Human); CVCL_0419
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Transwell assay
• Mechanism Description: miR-485-5p suppresses breast cancer progression and enhances chemosensitivity through down-regulation of survivin expression.

References

• Ref 1: hsa-miR-485-5p reverses epithelial to mesenchymal transition and promotes cisplatin-induced cell death by targeting PAK1 in oral tongue squamous cell carcinoma. Int J Mol Med. 2017 Jul;40(1):83-89. doi: 10.3892/ijmm.2017.2992. Epub 2017 May 16.
• Ref 2: miR-485-5p suppresses breast cancer progression and chemosensitivity by targeting survivin. Biochem Biophys Res Commun. 2018 Jun 18;501(1):48-54. doi: 10.1016/j.bbrc.2018.04.129. Epub 2018 Apr 22.