Molecule Information

General Information of the Molecule (ID: Mol01651)

Name	hsa-miR-451a ,Homo sapiens
Synonyms	microRNA 451a Click to Show/Hide
Molecule Type	Mature miRNA
Sequence	AAACCGUUACCAUUACUGAGUU Click to Show/Hide
Ensembl ID	ENSG00000284565
HGNC ID	HGNC:32053
Mature Accession	MIMAT0001631
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

1 drug(s) in total

Click to Show/Hide the Full List of Drugs

Tamoxifen

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Breast cancer				[1]
Sensitive Disease	Breast cancer [ICD-11: 2C60.3]			Disease Info
Sensitive Drug	Tamoxifen			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	AKT/mTOR signaling pathway		Regulation	hsa04150
	Cell apoptosis		Activation	hsa04210
	Cell proliferation		Inhibition	hsa05200
In Vitro Model	MCF-7 cells	Breast	Homo sapiens (Human)	CVCL_0031
	LCC2 cells	Breast	Homo sapiens (Human)	CVCL_DP51
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	MTT assay
Mechanism Description	Over-expression of miR-451a can enhance MCF-7 and LCC2 cell sensitivity to TAM. Opposite effects were elicited by knocking down miR-451a. TAM treatment can up-regulate 14-3-3Zeta expression, and down-regulate ERalpha expression. 14-3-3Zeta and ERalpha were shown to interact. Over-expression of miR-451a decreased 14-3-3Zeta expression and increased ERalpha expression, suppressing cell proliferation, increasing apoptosis, and reducing activation of p-AkT and p-mTOR.

References

Ref 1	Over-expression of miR-451a can enhance the sensitivity of breast cancer cells to tamoxifen by regulating 14-3-3 Zeta, estrogen receptor Alpha, and autophagy. Life Sci. 2016 Mar 15;149:104-13. doi: 10.1016/j.lfs.2016.02.059. Epub 2016 Feb 17.