Molecule Information

General Information of the Molecule (ID: Mol01649)

Name	hsa-miR-449a ,Homo sapiens
Synonyms	microRNA 449a Click to Show/Hide
Molecule Type	Mature miRNA
Sequence	UGGCAGUGUAUUGUUAGCUGGU Click to Show/Hide
Ensembl ID	ENSG00000198983
HGNC ID	HGNC:27645
Mature Accession	MIMAT0001541
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

2 drug(s) in total

Click to Show/Hide the Full List of Drugs

Cisplatin

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Ovarian cancer				[1]
Sensitive Disease	Ovarian cancer [ICD-11: 2C73.0]			Disease Info
Sensitive Drug	Cisplatin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell apoptosis		Activation	hsa04210
	Cell proliferation		Inhibition	hsa05200
	Notch signaling pathway		Inhibition	hsa04330
In Vitro Model	SkOV3 cells	Ovary	Homo sapiens (Human)	CVCL_0532
	A2780 cells	Ovary	Homo sapiens (Human)	CVCL_0134
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	WST-8 dye assay; Flow cytometry assay
Mechanism Description	miR-449a was involved in cisplatin resistance and the overexpression of miR449a increased cisplatin sensitivity mainly through inhibiting proliferation and promoting apoptosis and the direct downregulating the expression of NOTCH1.

Tamoxifen

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Breast cancer				[2]
Resistant Disease	Breast cancer [ICD-11: 2C60.3]			Disease Info
Resistant Drug	Tamoxifen			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Identified from the Human Clinical Data
Cell Pathway Regulation	Cell viability		Activation	hsa05200
In Vitro Model	MCF-7 cells	Breast	Homo sapiens (Human)	CVCL_0031
	T47D cells	Breast	Homo sapiens (Human)	CVCL_0553
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	CCK8 assay
Mechanism Description	Decreased miR-449a causes the upregulation of ADAM22, which induces tamoxifen resistance of breast cancer cells.

References

Ref 1	MicroRNA-449a reduces cell survival and enhances cisplatin-induced cytotoxicity via downregulation of NOTCH1 in ovarian cancer cells. Tumour Biol. 2014 Dec;35(12):12369-78. doi: 10.1007/s13277-014-2551-3. Epub 2014 Sep 2.
Ref 2	miR-449a Suppresses Tamoxifen Resistance in Human Breast Cancer Cells by Targeting ADAM22. Cell Physiol Biochem. 2018;50(1):136-149. doi: 10.1159/000493964. Epub 2018 Oct 2.