Molecule Information

General Information of the Molecule (ID: Mol01647)

• Name: hsa-miR-425-3p ,Homo sapiens
• Synonyms: microRNA 425
• Molecule Type: Mature miRNA
• Sequence: AUCGGGAAUGUCGUGUCCGCCC
• Ensembl ID: ENSG00000199032
• HGNC ID: HGNC:31882
• Mature Accession: MIMAT0001343

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Sorafenib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [1]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Sorafenib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: HepG2 HCC cells; Liver; Homo sapiens (Human); CVCL_0027
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: MTT assay; EdU assay
• Mechanism Description: miR-425-3p levels were induced by sorafenib incubation in HuH-7 cells-derived exosomes, and this cell line was more sensitive to cell death after incubation with the drug. The involvement of extracellular vesicles in modulating HCC response to sorafenib has recently emerged providing a potential novel strategy to interfere with HCC chemoresistance.

References

• Ref 1: MicroRNA-425-3p predicts response to sorafenib therapy in patients with hepatocellular carcinoma. Liver Int. 2015 Mar;35(3):1077-86. doi: 10.1111/liv.12636. Epub 2014 Jul 21.