Molecule Information

General Information of the Molecule (ID: Mol01644)

• Name: hsa-miR-346 ,Homo sapiens
• Synonyms: microRNA 346
• Molecule Type: Mature miRNA
• Sequence: UGUCUGCCCGCAUGCCUGCCUCU
• Ensembl ID: ENSG00000199104
• HGNC ID: HGNC:31780
• Mature Accession: MIMAT0000773

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Docetaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [1]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Docetaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: HBL-100 cells; Breast; Homo sapiens (Human); CVCL_4362
• In Vitro Model: MCF-7/Doc cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR346 promotes the biological function of breast cancer cells by targeting SRCIN1 and reduces chemosensitivity to docetaxel. Overexpression of miR346 promoted cell proliferation, colony formation, migration and invasion, and reduced apoptosis, sensitivity to Docetaxel.

References

• Ref 1: MiR-346 promotes the biological function of breast cancer cells by targeting SRCIN1 and reduces chemosensitivity to docetaxel. Gene. 2017 Feb 5;600:21-28. doi: 10.1016/j.gene.2016.11.037. Epub 2016 Nov 29.