Molecule Information

General Information of the Molecule (ID: Mol01643)
Name
hsa-miR-133b ,Homo sapiens
Synonyms
microRNA 133b
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UUUGGUCCCCUUCAACCAGCUA
    Click to Show/Hide
Ensembl ID
ENSG00000199080
HGNC ID
HGNC:31759
Mature Accession
MIMAT0000770
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung cancer [1], [2]
Sensitive Disease Lung cancer [ICD-11: 2C25.5]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell colony Inhibition hsa05200
Cell proliferation Inhibition hsa05200
In Vitro Model A549/DPP cells Lung Homo sapiens (Human) CVCL_0023
H1299/DDP cells Lung Homo sapiens (Human) CVCL_0060
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 CCK8 assay; Flow cytometry assay
Mechanism Description miR133b reduces cisplatin resistance and its overexpression contributes to the suppression of the malignant growth and aggressiveness of cisplatin-resistant NSCLC cells by targeting GSTP1.
Disease Class: Ovarian cancer [3]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model A2780 cells Ovary Homo sapiens (Human) CVCL_0134
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Overexpression of miR-133b increases ovarian cancer cell sensitivity to cisplatin and paclitaxel by decreasing GST-Pi and MDR1 expression.
Gefitinib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [4]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
 Disease Info 
Sensitive Drug Gefitinib
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell migration Inhibition hsa04670
EGFR signaling pathway Inhibition hsa01521
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
NCI-H1650 cells Lung Homo sapiens (Human) CVCL_1483
PC9 cells Lung Homo sapiens (Human) CVCL_B260
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-133b suppresses the expression of EGFR, miR-133b transfection may modulate apoptosis, invasion and sensitivity to EGFR-TkI through the EGFR signaling pathways.
Paclitaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [3]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
 Disease Info 
Sensitive Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model A2780 cells Ovary Homo sapiens (Human) CVCL_0134
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Overexpression of miR-133b increases ovarian cancer cell sensitivity to cisplatin and paclitaxel by decreasing GST-Pi and MDR1 expression.
References
Ref 1 [MiR-133b Affect the Proliferation and Drug Sensitivity in A549 Lung Cancer Stem Cells by Targeting PKM2]. Zhongguo Fei Ai Za Zhi. 2017 Jun 20;20(6):376-381. doi: 10.3779/j.issn.1009-3419.2017.06.02.
Ref 2 miR-133b reverses cisplatin resistance by targeting GSTP1 in cisplatin-resistant lung cancer cells. Int J Mol Med. 2018 Apr;41(4):2050-2058. doi: 10.3892/ijmm.2018.3382. Epub 2018 Jan 11.
Ref 3 MicroRNA-133b targets glutathione S-transferase Pi expression to increase ovarian cancer cell sensitivity to chemotherapy drugs. Drug Des Devel Ther. 2015 Sep 16;9:5225-35. doi: 10.2147/DDDT.S87526. eCollection 2015.
Ref 4 MicroRNA-133b inhibits the growth of non-small-cell lung cancer by targeting the epidermal growth factor receptor. FEBS J. 2012 Oct;279(20):3800-12. doi: 10.1111/j.1742-4658.2012.08741.x. Epub 2012 Sep 11.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.