Molecule Information

General Information of the Molecule (ID: Mol01641)

• Name: hsa-miR-338-3p ,Homo sapiens
• Synonyms: microRNA 338
• Molecule Type: Mature miRNA
• Sequence: UCCAGCAUCAGUGAUUUUGUUG
• Ensembl ID: ENSG00000283604
• HGNC ID: HGNC:31775
• Mature Accession: MIMAT0000763

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [1]

• Sensitive Disease: Colon cancer [ICD-11: 2B90.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: miR338-3p/mTOR signaling pathway; Activation; hsa05206
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometric analysis
• Mechanism Description: miR338-3p increased 5-FU resistance by reducing the expression of its target gene, mTOR; and miR338-3p inhibitor sensitized HT29 (mutant p53) and HCT116 p53-/- (deficient p53) cells by activating mTOR; and miR338-3p-mTOR-autophagy was in the competition with 5-FU-induced apoptosis and contributed to the subsequent 5-FU resistance. (Inhibition of mTOR induces autophagy and depresses apoptosis to confer resistance to 5-FU).

Sorafenib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular cancer [2]

• Sensitive Disease: Hepatocellular cancer [ICD-11: 2C12.4]
• Sensitive Drug: Sorafenib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: HIF signaling signaling pathway; Inhibition; hsa04066
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: BEL-7402 cells; Liver; Homo sapiens (Human); CVCL_5492
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Hep3B cells; Liver; Homo sapiens (Human); CVCL_0326
• In Vitro Model: SMMC7721 cells; Uterus; Homo sapiens (Human); CVCL_0534
• In Vitro Model: L02 cells; Liver; Homo sapiens (Human); CVCL_6926
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: Overexpression of miR-338-3p inhibited HIF-1alpha 3'-UTR luciferase activity and HIF-1alpha protein levels in HepG2, SMMC-7721, and Huh7 cells. miR-338-3p significantly reduced cell viability and induced cell apoptosis of HCC cells. Additionally, HIF-1alpha overexpression rescued and HIF-1alpha knock-down abrogated the anti-HCC activity of miR-338-3p. Furthermore, miR-338-3p sensitized HCC cells to sorafenib in vitro and in a HCC subcutaneous nude mice tumor model by inhibiting HIF-1alpha. Collectively, miR-338-3p inhibits HCC tumor growth and sensitizes HCC cells to sorafenib by down-regulating HIF-1alpha.

References

• Ref 1: miR-338-3p confers 5-fluorouracil resistance in p53 mutant colon cancer cells by targeting the mammalian target of rapamycin. Exp Cell Res. 2017 Nov 15;360(2):328-336. doi: 10.1016/j.yexcr.2017.09.023. Epub 2017 Sep 18.
• Ref 2: MiR-338-3p inhibits hepatocarcinoma cells and sensitizes these cells to sorafenib by targeting hypoxia-induced factor 1Alpha. PLoS One. 2014 Dec 22;9(12):e115565. doi: 10.1371/journal.pone.0115565. eCollection 2014.