General Information of the Molecule (ID: Mol01635)
Name
hsa-miR-342-3p ,Homo sapiens
Synonyms
microRNA 342
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UCUCACACAGAAAUCGCACCCGU
    Click to Show/Hide
Ensembl ID
ENSG00000199082
HGNC ID
HGNC:31778
Mature Accession
MIMAT0000753
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [1]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description Triple-negative breast cancer with high expression of miR-342-3p is more sensitive to chemotherapy drugs, and miR-342-3p can regulate the chemotherapy sensitivity of breast cancer cell line MDA-MB-231 to paclitaxel and cisplatin.
Paclitaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [1]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description Triple-negative breast cancer with high expression of miR-342-3p is more sensitive to chemotherapy drugs, and miR-342-3p can regulate the chemotherapy sensitivity of breast cancer cell line MDA-MB-231 to paclitaxel and cisplatin.
References
Ref 1 [Effect of miR-342-3p on chemotherapy sensitivity in triple-negative breast cancer]. Zhong Nan Da Xue Xue Bao Yi Xue Ban. 2014 May;39(5):488-95. doi: 10.3969/j.issn.1672-7347.2014.05.009.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.