Molecule Information

General Information of the Molecule (ID: Mol01628)

• Name: hsa-miR-367-3p ,Homo sapiens
• Synonyms: microRNA 367
• Molecule Type: Mature miRNA
• Sequence: AAUUGCACUUUAGCAAUGGUGA
• Ensembl ID: ENSG00000199169
• HGNC ID: HGNC:31781
• Mature Accession: MIMAT0000719

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Sorafenib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [1]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Sorafenib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: MDM2/AR-FkBP5/PHLPP signaling pathway; Regulation; hsa04115
• Cell Pathway Regulation: AKT/ERK signaling pathway; Regulation; hsa04010
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: SNU398 cells; Liver; Homo sapiens (Human); CVCL_0077
• In Vitro Model: Skhep1 cells; Liver; Homo sapiens (Human); CVCL_0525
• In Vitro Model: HA22T cells; Liver; Homo sapiens (Human); CVCL_7046
• In Vitro Model: SNU423 cells; Liver; Homo sapiens (Human); CVCL_0366
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: 3D Invasion Assay
• Mechanism Description: miR367-3p could increase AR expression via directly targeting the 3'UTR of MDM2 to decrease MDM2 protein expression. The resultant increase of AR expression might then promote the expression of FkBP5 and PHLPP, thus dephosphorylating and inactivating AkT and ERk, to suppress the HCC cell invasion. miR367-3p may function as an AR enhancer to increase Sorafenib chemotherapy efficacy via altering the MDM2/AR/FkBP5/PHLPP/(pAkT and pERk) signals to better suppress HCC metastasis.

References

• Ref 1: The miR-367-3p Increases Sorafenib Chemotherapy Efficacy to Suppress Hepatocellular Carcinoma Metastasis through Altering the Androgen Receptor Signals. EBioMedicine. 2016 Oct;12:55-67. doi: 10.1016/j.ebiom.2016.07.013. Epub 2016 Jul 14.