Molecule Information

General Information of the Molecule (ID: Mol01623)

• Name: hsa-miR-29c-3p ,Homo sapiens
• Synonyms: microRNA 29c
• Molecule Type: Mature miRNA
• Sequence: UAGCACCAUUUGAAAUCGGUUA
• Ensembl ID: ENSG00000284214
• HGNC ID: HGNC:31621
• Mature Accession: MIMAT0000681

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Endometrial carcinoma [1]

• Sensitive Disease: Endometrial carcinoma [ICD-11: 2C76.2]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell colony; Inhibition; hsa05200
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• Cell Pathway Regulation: miR125a-5p/BCL2/MRP4 signaling pathway; Regulation; hsa05206
• In Vitro Model: Ishikawa cells; Endometrium; Homo sapiens (Human); CVCL_2529
• In Vitro Model: HEC-1A cells; Uterus; Homo sapiens (Human); CVCL_0293
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The up-regulation of miR-29c-3p using exogenous mimic molecules markedly increased PTX sensitivity in both cell lines and reduced expression of kDM5B while the inhibitor of miR-29-3p resulted in the opposite effects.

References

• Ref 1: Investigation of the potential theranostic role of KDM5B/miR-29c signaling axis in paclitaxel resistant endometrial carcinoma. Gene. 2019 Apr 30;694:76-82. doi: 10.1016/j.gene.2018.12.076. Epub 2019 Jan 16.