General Information of the Molecule (ID: Mol01622)
Name
hsa-miR-106b-5p ,Homo sapiens
Synonyms
microRNA 106b
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UAAAGUGCUGACAGUGCAGAU
    Click to Show/Hide
Ensembl ID
ENSG00000208036
HGNC ID
HGNC:31495
Mature Accession
MIMAT0000680
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Seminoma [1]
Resistant Disease Seminoma [ICD-11: 2C80.3]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
PI3K/AKT/mTOR signaling pathway Regulation hsa04151
In Vitro Model TCam-2 cells Testicle Homo sapiens (Human) CVCL_T012
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description Long non-coding RNA H19 promotes TDRG1 expression and cisplatin resistance by sequestering miRNA-106b-5p in seminoma.
Disease Class: Seminoma [1]
Resistant Disease Seminoma [ICD-11: 2C80.3]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
PI3K/AKT/mTOR signaling pathway Regulation hsa04151
In Vitro Model TCam-2 cells Testicle Homo sapiens (Human) CVCL_T012
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description Long non-coding RNA H19 promotes TDRG1 expression and cisplatin resistance by sequestering miRNA-106b-5p in seminoma.
Disease Class: Non-small cell lung cancer [2]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
A549/DDP cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometric analysis
Mechanism Description miR106b-5p enhanced the sensitivity of A549/DDP cells to cisplatin by targeting the expression of PkD2.
References
Ref 1 Long non-coding RNA H19 promotes TDRG1 expression and cisplatin resistance by sequestering miRNA-106b-5p in seminoma. Cancer Med. 2018 Dec;7(12):6247-6257. doi: 10.1002/cam4.1871. Epub 2018 Nov 14.
Ref 2 MicroRNA-106b-5p regulates cisplatin chemosensitivity by targeting polycystic kidney disease-2 in non-small-cell lung cancer. Anticancer Drugs. 2017 Sep;28(8):852-860. doi: 10.1097/CAD.0000000000000524.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.