Molecule Information

General Information of the Molecule (ID: Mol01621)

• Name: hsa-miR-155-5p ,Homo sapiens
• Synonyms: microRNA 155
• Molecule Type: Mature miRNA
• Sequence: UUAAUGCUAAUCGUGAUAGGGGUU
• Ensembl ID: ENSG00000283904
• HGNC ID: HGNC:31542
• Mature Accession: MIMAT0000646

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Gastric cancer [1]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: MGC-803 cells; Gastric; Homo sapiens (Human); CVCL_5334
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Exosomal delivery of miR 155 5p may induce EMT and chemoresistant phenotypes from paclitaxel resistant gastric cancer cells to the sensitive cells, which may be mediated by GATA3 and TP53INP1 suppression.

References

• Ref 1: Paclitaxel resistant gastric cancer MGC 803 cells promote epithelial to mesenchymal transition and chemoresistance in paclitaxel sensitive cells via exosomal delivery of miR 155 5p. Int J Oncol. 2019 Jan;54(1):326-338. doi: 10.3892/ijo.2018.4601. Epub 2018 Oct 22.