Molecule Information

General Information of the Molecule (ID: Mol01620)

• Name: hsa-miR-200c-3p ,Homo sapiens
• Synonyms: microRNA 200c
• Molecule Type: Mature miRNA
• Sequence: UAAUACUGCCGGGUAAUGAUGGA
• Ensembl ID: ENSG00000207713
• HGNC ID: HGNC:31580
• Mature Accession: MIMAT0000617

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [1]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: Down-regulation of miR 200c 3p contributes to the resistance of breast cancer cells to paclitaxel by targeting SOX2.

References

• Ref 1: Downregulation of miR 200c 3p contributes to the resistance of breast cancer cells to paclitaxel by targeting SOX2. Oncol Rep. 2018 Dec;40(6):3821-3829. doi: 10.3892/or.2018.6735. Epub 2018 Sep 26.