Molecule Information

General Information of the Molecule (ID: Mol01618)

• Name: hsa-miR-195-5p ,Homo sapiens
• Synonyms: microRNA 195
• Molecule Type: Mature miRNA
• Sequence: UAGCAGCACAGAAAUAUUGGC
• Ensembl ID: ENSG00000284112
• HGNC ID: HGNC:31566
• Mature Accession: MIMAT0000461

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [1]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: MkN28 cells; Gastric; Homo sapiens (Human); CVCL_1416
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Overexpression of miR 195 5p inhibit multi drug resistance of gastric cancer cells via downregulating ZNF139.

Disease Class: Colorectal cancer [2]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• Cell Pathway Regulation: Notch signaling pathway; Inhibition; hsa04330
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: SW620 cells; Colon; Homo sapiens (Human); CVCL_0547
• In Vitro Model: HT-29 cells; Colon; Homo sapiens (Human); CVCL_0320
• In Vitro Model: HCT-160 cells; Colorectal; Homo sapiens (Human); N.A.
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Caspase-3 activity
• Mechanism Description: miR-195-5p regulates CRC cell stemness and 5-FU resistance through Notch2 and RBPJ.

Oxaliplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [1]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Oxaliplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: MkN28 cells; Gastric; Homo sapiens (Human); CVCL_1416
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Overexpression of miR 195 5p inhibit multi drug resistance of gastric cancer cells via downregulating ZNF139.

References

• Ref 1: miR 195 5p regulates multi drug resistance of gastric cancer cells via targeting ZNF139. Oncol Rep. 2018 Sep;40(3):1370-1378. doi: 10.3892/or.2018.6524. Epub 2018 Jun 25.
• Ref 2: Overcoming stemness and chemoresistance in colorectal cancer through miR-195-5p-modulated inhibition of notch signaling. Int J Biol Macromol. 2018 Oct 1;117:445-453. doi: 10.1016/j.ijbiomac.2018.05.151. Epub 2018 May 28.