Molecule Information
General Information of the Molecule (ID: Mol01617)
Name |
hsa-miR-194-5p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 194-1
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
UGUAACAGCAACUCCAUGUGGA
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Paclitaxel
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
Epigenetic Alteration of DNA, RNA or Protein (EADR) | ||||
Disease Class: Ovarian cancer | [1] | |||
Resistant Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
Resistant Drug | Paclitaxel | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell viability | Activation | hsa05200 | |
In Vitro Model | Hey A8 cells | Ovary | Homo sapiens (Human) | CVCL_8878 |
SkVO3ip1 cells | Ovary | Homo sapiens (Human) | CVCL_0C84 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTS assay | |||
Mechanism Description | Down-regulation of miR-194-5p induces paclitaxel resistance in ovarian cancer cells by altering MDM2 expression. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.