Molecule Information

General Information of the Molecule (ID: Mol01612)

Name	hsa-miR-146a-5p ,Homo sapiens
Synonyms	microRNA 146a Click to Show/Hide
Molecule Type	Mature miRNA
Sequence	UGAGAACUGAAUUCCAUGGGUU Click to Show/Hide
Ensembl ID	ENSG00000283733
HGNC ID	HGNC:31533
Mature Accession	MIMAT0000449
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

1 drug(s) in total

Click to Show/Hide the Full List of Drugs

Cisplatin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Non-small cell lung cancer				[1]
Resistant Disease	Non-small cell lung cancer [ICD-11: 2C25.Y]			Disease Info
Resistant Drug	Cisplatin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	A549 cells	Lung	Homo sapiens (Human)	CVCL_0023
	A549/DDP cells	Lung	Homo sapiens (Human)	CVCL_0023
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	MTT assay
Mechanism Description	miR146a-5p increases chemosensitivity of NSCLC to cisplatin by targeting Atg12 to inhibit autophagy.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Ovarian cancer				[2]
Sensitive Disease	Ovarian cancer [ICD-11: 2C73.0]			Disease Info
Sensitive Drug	Cisplatin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell apoptosis		Activation	hsa04210
In Vitro Model	SkOV3 cells	Ovary	Homo sapiens (Human)	CVCL_0532
	OVCAR3 cells	Ovary	Homo sapiens (Human)	CVCL_0465
Experiment for Molecule Alteration	Dual-luciferase assay
Experiment for Drug Resistance	MTT assay
Mechanism Description	microRNA 146a 5p enhances cisplatin induced apoptosis in ovarian cancer cells by targeting multiple anti apoptotic genes, including XIAP, BCL2L2 and BIRC5 via their 3'UTRs.

References

Ref 1	MiR-146a-5p level in serum exosomes predicts therapeutic effect of cisplatin in non-small cell lung cancer. Eur Rev Med Pharmacol Sci. 2017 Jun;21(11):2650-2658.
Ref 2	MicroRNA 146a 5p enhances cisplatin induced apoptosis in ovarian cancer cells by targeting multiple anti apoptotic genes. Int J Oncol. 2017 Jul;51(1):327-335. doi: 10.3892/ijo.2017.4023. Epub 2017 May 29.