Molecule Information

General Information of the Molecule (ID: Mol01611)

• Name: hsa-miR-134-5p ,Homo sapiens
• Synonyms: microRNA 134
• Molecule Type: Mature miRNA
• Sequence: UGUGACUGGUUGACCAGAGGGG
• Ensembl ID: ENSG00000207993
• HGNC ID: HGNC:31519
• Mature Accession: MIMAT0000447

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Cervical cancer [1]

• Sensitive Disease: Cervical cancer [ICD-11: 2C77.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: Hela cells; Cervix uteri; Homo sapiens (Human); CVCL_0030
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: Silencing of NCk1-AS1 and upregulation of miR-134-5p promote HeLa cell apoptosis and reduce cisplatin resistance in cervical cancer cells.

References

• Ref 1: Suppression of long noncoding RNA NCK1-AS1 increases chemosensitivity to cisplatin in cervical cancer. J Cell Physiol. 2019 Apr;234(4):4302-4313. doi: 10.1002/jcp.27198. Epub 2018 Sep 17.