General Information of the Molecule (ID: Mol01609)
Name
hsa-miR-126-3p ,Homo sapiens
Synonyms
microRNA 126
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UCGUACCGUGAGUAAUAAUGCG
    Click to Show/Hide
Ensembl ID
ENSG00000199161
HGNC ID
HGNC:31508
Mature Accession
MIMAT0000445
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Click to Show/Hide the Full List of Drugs
Dabrafenib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Melanoma [1]
Resistant Disease Melanoma [ICD-11: 2C30.0]
Resistant Drug Dabrafenib
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell invasion Activation hsa05200
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
In Vitro Model A375 cells Skin Homo sapiens (Human) CVCL_0132
Sk-Mel28 cells Skin Homo sapiens (Human) CVCL_0526
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description miR-126-3p down-regulation contributes to dabrafenib acquired resistance in melanoma by up-regulating ADAM9 and VEGF-A.
Temozolomide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioblastoma [2]
Sensitive Disease Glioblastoma [ICD-11: 2A00.02]
Sensitive Drug Temozolomide
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell autophagy Inhibition hsa04140
Wnt/Beta-catenin signaling pathway Activation hsa04310
In Vitro Model U251 cells Brain Homo sapiens (Human) CVCL_0021
U87 cells Brain Homo sapiens (Human) CVCL_0022
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Colony formation assay; Flow cytometry assay
Mechanism Description miR-126-3p sensitizes glioblastoma cells to temozolomide by inactivating Wnt/beta-catenin signaling via targeting SOX2.
References
Ref 1 miR-126-3p down-regulation contributes to dabrafenib acquired resistance in melanoma by up-regulating ADAM9 and VEGF-A. J Exp Clin Cancer Res. 2019 Jun 21;38(1):272. doi: 10.1186/s13046-019-1238-4.
Ref 2 miR-126-3p sensitizes glioblastoma cells to temozolomide by inactivating Wnt/Beta-catenin signaling via targeting SOX2. Life Sci. 2019 Jun 1;226:98-106. doi: 10.1016/j.lfs.2019.04.023. Epub 2019 Apr 10.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.