Molecule Information

General Information of the Molecule (ID: Mol01607)

• Name: hsa-miR-125a-5p ,Homo sapiens
• Synonyms: microRNA 125a
• Molecule Type: Mature miRNA
• Sequence: UCCCUGAGACCCUUUAACCUGUGA
• Ensembl ID: ENSG00000208008
• HGNC ID: HGNC:31505
• Mature Accession: MIMAT0000443

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Osteosarcoma [1]

• Sensitive Disease: Osteosarcoma [ICD-11: 2B51.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell colony; Inhibition; hsa05200
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: HEK293T cells; Kidney; Homo sapiens (Human); CVCL_0063
• In Vitro Model: MG63 cells; Bone marrow; Homo sapiens (Human); CVCL_0426
• In Vitro Model: SAOS-2 cells; Bone marrow; Homo sapiens (Human); CVCL_0548
• In Vitro Model: U2OS cells; Bone; Homo sapiens (Human); CVCL_0042
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: ANRIL-silenced cells were more sensitive to cisplatin and the expression level of miR-125a-5p was elevated in ANRIL-silenced cells.

Disease Class: Esophageal squamous cell carcinoma [2]

• Sensitive Disease: Esophageal squamous cell carcinoma [ICD-11: 2B70.3]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: STAT3 signaling pathway; Inhibition; hsa04550
• In Vitro Model: ECA-109 cells; Esophagus; Homo sapiens (Human); CVCL_6898
• In Vitro Model: TE-1 cells; Esophagus; Homo sapiens (Human); CVCL_1759
• In Vitro Model: EC9706 cells; Esophagus; Homo sapiens (Human); CVCL_E307
• In Vitro Model: EC1 cells; Esophagus; Homo sapiens (Human); CVCL_DC74
• In Vitro Model: KYSE70 cells; Esophagus; Homo sapiens (Human); CVCL_1356
• In Vitro Model: kYSE450 cells; Esophagus; Homo sapiens (Human); CVCL_1353
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay; Would healing assay; Invasion assay
• Mechanism Description: miR 125a 5p and cisplatin markedly inactivated the STAT3 signaling pathway.

Imatinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastrointestinal stromal tumor [3]

• Resistant Disease: Gastrointestinal stromal tumor [ICD-11: 2B5B.0]
• Resistant Drug: Imatinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: GIST882 cells; Gastric; Homo sapiens (Human); CVCL_7044
• In Vitro Model: GIST48 cells; Gastric; Homo sapiens (Human); CVCL_7041
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: WST-1 assay
• Mechanism Description: miR-125a-5p expression modulated imatinib sensitivity in GIST882 cells with a homozygous kIT mutation but not in GIST48 cells with double kIT mutations. Overexpression of miR-125a-5p suppressed PTPN18 expression, and silencing of PTPN18 expression increased cell viability in GIST882 cells upon imatinib treatment. PTPN18 protein levels were significantly lower in the imatinib-resistant GISTs and inversely correlated with miR-125a-5p. Furthermore, several microRNAs were significantly associated with metastasis, kIT mutational status and survival.

References

• Ref 1: Effect of lncRNA ANRIL knockdown on proliferation and cisplatin chemoresistance of osteosarcoma cells in vitro. Pathol Res Pract. 2019 May;215(5):931-938. doi: 10.1016/j.prp.2019.01.042. Epub 2019 Jan 30.
• Ref 2: MicroRNA-125a-5p enhances the sensitivity of esophageal squamous cell carcinoma cells to cisplatin by suppressing the activation of the STAT3 signaling pathway. Int J Oncol. 2018 Aug;53(2):644-658. doi: 10.3892/ijo.2018.4409. Epub 2018 May 16.
• Ref 3: microRNA expression signatures of gastrointestinal stromal tumours: associations with imatinib resistance and patient outcome. Br J Cancer. 2014 Nov 25;111(11):2091-102. doi: 10.1038/bjc.2014.548. Epub 2014 Oct 30.