General Information of the Molecule (ID: Mol01602)
Name
hsa-miR-142-5p ,Homo sapiens
Synonyms
microRNA 142
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
CAUAAAGUAGAAAGCACUACU
    Click to Show/Hide
Ensembl ID
ENSG00000284353
HGNC ID
HGNC:31529
Mature Accession
MIMAT0000433
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [1]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell viability Inhibition hsa05200
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
HEK293T cells Kidney Homo sapiens (Human) CVCL_0063
OVCAR3 cells Ovary Homo sapiens (Human) CVCL_0465
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description miR-142-5p decreases cisplatin IC50 in OVCAR3 and SkOV3 ovarian cancer cells via downregulating XIAP.
Gemcitabine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Pancreatic cancer [2]
Sensitive Disease Pancreatic cancer [ICD-11: 2C10.3]
Sensitive Drug Gemcitabine
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model Capan-1 cells Pancreas Homo sapiens (Human) CVCL_0237
SUIT-2 cells Pancreas Homo sapiens (Human) CVCL_3172
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Propidium iodide assay
Mechanism Description High miR-142-5p expression was significantly associated with longer survival times in the gemcitabine group.
References
Ref 1 miR-142-5p enhances cisplatin-induced apoptosis in ovarian cancer cells by targeting multiple anti-apoptotic genes. Biochem Pharmacol. 2019 Mar;161:98-112. doi: 10.1016/j.bcp.2019.01.009. Epub 2019 Jan 11.
Ref 2 MicroRNA expression as a predictive marker for gemcitabine response after surgical resection of pancreatic cancer. Ann Surg Oncol. 2011 Aug;18(8):2381-7. doi: 10.1245/s10434-011-1602-x. Epub 2011 Feb 23.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.