Molecule Information
General Information of the Molecule (ID: Mol01602)
Name |
hsa-miR-142-5p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 142
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
CAUAAAGUAGAAAGCACUACU
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Cisplatin
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
Epigenetic Alteration of DNA, RNA or Protein (EADR) | ||||
Disease Class: Ovarian cancer | [1] | |||
Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell viability | Inhibition | hsa05200 | ||
In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
HEK293T cells | Kidney | Homo sapiens (Human) | CVCL_0063 | |
OVCAR3 cells | Ovary | Homo sapiens (Human) | CVCL_0465 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | miR-142-5p decreases cisplatin IC50 in OVCAR3 and SkOV3 ovarian cancer cells via downregulating XIAP. |
Gemcitabine
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
Epigenetic Alteration of DNA, RNA or Protein (EADR) | ||||
Disease Class: Pancreatic cancer | [2] | |||
Sensitive Disease | Pancreatic cancer [ICD-11: 2C10.3] | |||
Sensitive Drug | Gemcitabine | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
In Vitro Model | Capan-1 cells | Pancreas | Homo sapiens (Human) | CVCL_0237 |
SUIT-2 cells | Pancreas | Homo sapiens (Human) | CVCL_3172 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Propidium iodide assay | |||
Mechanism Description | High miR-142-5p expression was significantly associated with longer survival times in the gemcitabine group. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.