Molecule Information

General Information of the Molecule (ID: Mol01595)

• Name: hsa-miR-124-3p ,Homo sapiens
• Synonyms: microRNA 124-1
• Molecule Type: Mature miRNA
• Sequence: UAAGGCACGCGGUGAAUGCCAA
• Ensembl ID: ENSG00000284321
• HGNC ID: HGNC:31502
• Mature Accession: MIMAT0000422

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Dezocine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pain [1]

• Resistant Disease: Pain [ICD-11: MG30.0]
• Resistant Drug: Dezocine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Discovered Using In-vivo Testing Model
• Experiment for Molecule Alteration: Western blot analysis; Quantitative reverse-transcription PCR assay
• Mechanism Description: miR-124-3p alleviates the dezocine tolerance against pain by regulating TRAF6 in a rat model. miR-124-3p expression was highly downregulated in a dezocine-resistant model. miR-124-3p overexpression could alleviate dezocine tolerance in rats. TRAF6 expression was significantly upregulated in a dezocine-resistant model. miR-124-3p targeted TRAF6 and TRAF6 was negatively modulated by miR-124-3p. In addition, overexpression of TRAF6 could reverse the inhibitory effects of miR-124-3p on dezocine tolerance. Overexpression of miR-124-3p alleviates dezocine tolerance against pain via regulating TRAF6 in a rat model, providing a possible solution to address dezocine tolerance in clinical.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [2]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: HEK293T cells; Kidney; Homo sapiens (Human); CVCL_0063
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay; Transwell assay; Scratch assay
• Mechanism Description: The combination of downregulation of ABCC4 with overexpression of miR-124-3p significantly increased sensitivity to ADR in MCF-7-ADR cells.

Gefitinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [3]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Gefitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: SPC-A1 cells; Lung; Homo sapiens (Human); CVCL_6955
• In Vitro Model: NCI-H1650 cells; Lung; Homo sapiens (Human); CVCL_1483
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: USP14 is a direct target of hsa-miR-124a, and that hsa-miR-124a inhibits stemness and enhances the gefitinib sensitivity of NSCLC cells by targeting USP14.

References

• Ref 1: MiR-124-3p alleviates the dezocine tolerance against pain by regulating TRAF6 in a rat model .Neuroreport. 2021 Jan 6;32(1):44-51. doi: 10.1097/WNR.0000000000001559. 10.1097/WNR.0000000000001559
• Ref 2: Dual-Targeting of miR-124-3p and ABCC4 Promotes Sensitivity to Adriamycin in Breast Cancer Cells. Genet Test Mol Biomarkers. 2019 Mar;23(3):156-165. doi: 10.1089/gtmb.2018.0259. Epub 2019 Feb 26.
• Ref 3: Tumor suppressive microRNA-124a inhibits stemness and enhances gefitinib sensitivity of non-small cell lung cancer cells by targeting ubiquitin-specific protease 14. Cancer Lett. 2018 Jul 28;427:74-84. doi: 10.1016/j.canlet.2018.04.022. Epub 2018 Apr 24.