Molecule Information

General Information of the Molecule (ID: Mol01594)

• Name: hsa-miR-27b-3p ,Homo sapiens
• Synonyms: microRNA 27b
• Molecule Type: Mature miRNA
• Sequence: UUCACAGUGGCUAAGUUCUGC
• Ensembl ID: ENSG00000207864
• HGNC ID: HGNC:31614
• Mature Accession: MIMAT0000419

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Anaplastic thyroid carcinoma [1]

• Sensitive Disease: Anaplastic thyroid carcinoma [ICD-11: 2D10.3]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• Cell Pathway Regulation: miR27b-3p/PPARgamma signaling pathway; Regulation; hsa05206
• In Vitro Model: 8305C cells; Thyroid; Homo sapiens (Human); CVCL_1053
• In Vitro Model: SW1736 cells; Thyroid; Homo sapiens (Human); CVCL_3883
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: The inhibitor of miR-27b-3p can increase the Dox sensitivity of ATC Dox-resistant cells while over-expression of PPARGamma also increased the Dox sensitivity of ATC-resistant cells.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [2]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• Cell Pathway Regulation: MAPK/ERK signaling pathway; Inhibition; hsa04010
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: BCap37 cells; Breast; Homo sapiens (Human); CVCL_0164
• In Vitro Model: Bads-200 cells; Breast; Homo sapiens (Human); N.A.
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: miR-27b inhibits proliferation and resistance to PTX of breast cancer cell by repressing CBLB and GRB2 and suppresses activities of PI3k/AkT and MAPk/ERk signaling pathways through downregulation of CBLB and GRB2.

Tamoxifen

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [3]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: SkBR3 cells; Breast; Homo sapiens (Human); CVCL_0033
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: BT549 cells; Breast; Homo sapiens (Human); CVCL_1092
• In Vitro Model: MCF10A cells; Breast; Homo sapiens (Human); CVCL_0598
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay; Annexin V-FITC (fluorescein isothiocyanate)/PI analysis
• Mechanism Description: Down-regulation of microRNA-27b-3p enhances tamoxifen resistance in breast cancer by increasing NR5A2 and CREB1 expression. Overexpression of NR5A2 and CREB1 reverses reduction of cell viability and induction of apoptosis by miR27b-3p mimics, and depletion of NR5A2 and CREB1 reverses induction of cell viability and reduction of apoptosis by miR509-5p inhibitors in tamoxifen-treated cells.

References

• Ref 1: miR-27b-3p is Involved in Doxorubicin Resistance of Human Anaplastic Thyroid Cancer Cells via Targeting Peroxisome Proliferator-Activated Receptor Gamma. Basic Clin Pharmacol Toxicol. 2018 Dec;123(6):670-677. doi: 10.1111/bcpt.13076. Epub 2018 Aug 5.
• Ref 2: miR-27b-3p inhibits proliferation and potentially reverses multi-chemoresistance by targeting CBLB/GRB2 in breast cancer cells. Cell Death Dis. 2018 Feb 7;9(2):188. doi: 10.1038/s41419-017-0211-4.
• Ref 3: Downregulation of microRNA-27b-3p enhances tamoxifen resistance in breast cancer by increasing NR5A2 and CREB1 expression. Cell Death Dis. 2016 Nov 3;7(11):e2454. doi: 10.1038/cddis.2016.361.