Molecule Information

General Information of the Molecule (ID: Mol01589)

• Name: hsa-miR-221-3p ,Homo sapiens
• Synonyms: microRNA 221
• Molecule Type: Mature miRNA
• Sequence: AGCUACAUUGUCUGCUGGGUUUC
• Ensembl ID: ENSG00000207870
• HGNC ID: HGNC:31601
• Mature Accession: MIMAT0000278

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic cancer [1]

• Resistant Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: PANC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• In Vitro Model: PATU8988 cells; Pancreas; Homo sapiens (Human); CVCL_1846
• In Vitro Model: 293TN cells; Pancreas; Homo sapiens (Human); CVCL_UL49
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: 5-FU and gemcitabine assay; CCK8 assay; Wound healing assay; Transwell chamber invasion assay
• Mechanism Description: miRNA-221-3p desensitizes pancreatic cancer cells to 5-fluorouracil by targeting RB1. miR221-3p down-regulated RB1 expression by directly binding to its 3'-UTR and therefore caused increased several aspects of pancreatic cancer pathogenesis, including proliferation, migration, invasion, and epithelial-mesenchymal transition (EMT).

References

• Ref 1: MiRNA-221-3p desensitizes pancreatic cancer cells to 5-fluorouracil by targeting RB1. Tumour Biol. 2016 Oct 10. doi: 10.1007/s13277-016-5445-8. Online ahead of print.