Molecule Information

General Information of the Molecule (ID: Mol01586)

• Name: hsa-miR-218-5p ,Homo sapiens
• Synonyms: microRNA 218-1
• Molecule Type: Mature miRNA
• Sequence: UUGUGCUUGAUCUAACCAUGU
• Ensembl ID: ENSG00000207732
• HGNC ID: HGNC:31595
• Mature Accession: MIMAT0000275

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Gemcitabine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gallbladder cancer [1]

• Sensitive Disease: Gallbladder cancer [ICD-11: 2C13.0]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: PRKCE/MDR1 signaling pathway; Inhibition; hsa05206
• In Vitro Model: GBC-SD cells; Gallbladder; Homo sapiens (Human); CVCL_6903
• In Vitro Model: NOZ cells; Gallbladder; Homo sapiens (Human); CVCL_3079
• In Vitro Model: SGC-996 cells; Gallbladder; Homo sapiens (Human); CVCL_M737
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay; Annexin V assay
• Mechanism Description: miR218-5p restores sensitivity to gemcitabine through PRkCE/MDR1 axis in gallbladder cancer, miR218-5p promotes sensitivity of gemcitabine by abolishing PRkCE-induced upregulation of MDR1/P-gp.

References

• Ref 1: miR-218-5p restores sensitivity to gemcitabine through PRKCE/MDR1 axis in gallbladder cancer. Cell Death Dis. 2017 May 11;8(5):e2770. doi: 10.1038/cddis.2017.178.