Molecule Information
General Information of the Molecule (ID: Mol01584)
| Name |
hsa-miR-211-5p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 211
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
UUCCCUUUGUCAUCCUUCGCCU
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Vemurafenib
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
Epigenetic Alteration of DNA, RNA or Protein (EADR)
|
||||
| Disease Class: Melanoma | [1] | |||
| Resistant Disease | Melanoma [ICD-11: 2C30.0] | |||
| Resistant Drug | Vemurafenib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | ERK1/2/MEK activation signaling pathway|hsa04210) | Regulation | ||
| MAPK signaling pathway | Activation | hsa04010 | ||
| PI3K signaling pathway | Activation | hsa04151 | ||
| RAS signaling pathway | Activation | hsa04014 | ||
| In Vitro Model | A375 cells | Skin | Homo sapiens (Human) | CVCL_0132 |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR204-5p and miR211-5p contribute to BRAF inhibitor resistance in melanoma. MTT assays revealed a moderate but consistent increase in resistance to VMF in cells overexpressing miR211-5p or miR204-5p. Joint overexpression of miR204-5p and miR211-5p durably stimulated Ras and MAPk upregulation. Resistance to BRAFi in melanoma involves genetic alterations that lead to reactivation of the MAPk pathway or activation of PI3-k/AkT signalling. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.