Molecule Information

General Information of the Molecule (ID: Mol01582)

• Name: hsa-miR-205-5p ,Homo sapiens
• Synonyms: microRNA 205
• Molecule Type: Mature miRNA
• Sequence: UCCUUCAUUCCACCGGAGUCUG
• Ensembl ID: ENSG00000284485
• HGNC ID: HGNC:31583
• Mature Accession: MIMAT0000266

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Imatinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic myeloid leukemia [1]

• Resistant Disease: Chronic myeloid leukemia [ICD-11: 2A20.0]
• Resistant Drug: Imatinib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: K562 cells; Blood; Homo sapiens (Human); CVCL_0004
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: ABCC2 was a downstream target of miR205-5p, overexpression of miR205-5p suppressed the expression of ABCC2 in k562-R cells. SNHG5 promotes imatinib resistance through upregulating ABCC2. SNHG5 promotes imatinib resistance in CML via acting as a competing endogenous RNA against miR205-5p.

References

• Ref 1: LncRNA SNHG5 regulates imatinib resistance in chronic myeloid leukemia via acting as a CeRNA against MiR-205-5p. Am J Cancer Res. 2017 Aug 1;7(8):1704-1713. eCollection 2017.