Molecule Information
General Information of the Molecule (ID: Mol01580)
Name |
hsa-miR-199b-5p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 199b
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
CCCAGUGUUUAGACUAUCUGUUC
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Cisplatin
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
Epigenetic Alteration of DNA, RNA or Protein (EADR) | ||||
Disease Class: Ovarian cancer | [1] | |||
Resistant Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell proliferation | Activation | hsa05200 | |
JAG1/Notch1 signaling pathway | Activation | hsa04330 | ||
In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
A2780CP cells | Ovary | Homo sapiens (Human) | CVCL_0135 | |
OVCA433 cells | Ovary | Homo sapiens (Human) | CVCL_0475 | |
A2780s cells | Ovary | Homo sapiens (Human) | CVCL_4863 | |
C13 cells | Ovary | Homo sapiens (Human) | CVCL_0114 | |
OV2008 cells | Ovary | Homo sapiens (Human) | CVCL_0473 | |
ES-2 cells | Ovary | Homo sapiens (Human) | CVCL_3509 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
XTT assay | |||
Mechanism Description | The forced expression of miR-199b-5p could suppress ovarian cancer cell growth and sensitize the cells to cisplatin-induced cytotoxicity. On the other hand, as a direct target of miR-199b-5p in ovarian cancer cells, JAG1 depletion by siRNAs also resulted in cell growth retardation and sensitization to cisplatin-induced cytotoxicity. In contrast, activating Notch1 signaling by JAG1 or repressing miR-199b-5p by anti-miR-199b-5p could induce the activity of JAG1-Notch1 signaling in ovarian cancer cells. The loss of miR-199b-5p increased the activation of JAG1-Notch1 signaling, which in turn promoted ovarian cancer progression and acquired chemoresistance. |
Imatinib
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
Epigenetic Alteration of DNA, RNA or Protein (EADR) | ||||
Disease Class: Chronic myeloid leukemia | [2] | |||
Sensitive Disease | Chronic myeloid leukemia [ICD-11: 2A20.0] | |||
Sensitive Drug | Imatinib | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell viability | Inhibition | hsa05200 | ||
Wnt2-mediated Beta-catenin signaling pathway | Inhibition | hsa04310 | ||
In Vitro Model | K562 cells | Blood | Homo sapiens (Human) | CVCL_0004 |
Ku812 cells | Bone marrow | Homo sapiens (Human) | CVCL_0379 | |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | microRNA-199a/b-5p enhance imatinib efficacy via repressing WNT2 signaling-mediated protective autophagy in imatinib-resistant chronic myeloid leukemia cells. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.