General Information of the Molecule (ID: Mol01580)
Name
hsa-miR-199b-5p ,Homo sapiens
Synonyms
microRNA 199b
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
CCCAGUGUUUAGACUAUCUGUUC
    Click to Show/Hide
Ensembl ID
ENSG00000207581
HGNC ID
HGNC:31573
Mature Accession
MIMAT0000263
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [1]
Resistant Disease Ovarian cancer [ICD-11: 2C73.0]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Activation hsa05200
JAG1/Notch1 signaling pathway Activation hsa04330
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
A2780CP cells Ovary Homo sapiens (Human) CVCL_0135
OVCA433 cells Ovary Homo sapiens (Human) CVCL_0475
A2780s cells Ovary Homo sapiens (Human) CVCL_4863
C13 cells Ovary Homo sapiens (Human) CVCL_0114
OV2008 cells Ovary Homo sapiens (Human) CVCL_0473
ES-2 cells Ovary Homo sapiens (Human) CVCL_3509
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
XTT assay
Mechanism Description The forced expression of miR-199b-5p could suppress ovarian cancer cell growth and sensitize the cells to cisplatin-induced cytotoxicity. On the other hand, as a direct target of miR-199b-5p in ovarian cancer cells, JAG1 depletion by siRNAs also resulted in cell growth retardation and sensitization to cisplatin-induced cytotoxicity. In contrast, activating Notch1 signaling by JAG1 or repressing miR-199b-5p by anti-miR-199b-5p could induce the activity of JAG1-Notch1 signaling in ovarian cancer cells. The loss of miR-199b-5p increased the activation of JAG1-Notch1 signaling, which in turn promoted ovarian cancer progression and acquired chemoresistance.
Imatinib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Chronic myeloid leukemia [2]
Sensitive Disease Chronic myeloid leukemia [ICD-11: 2A20.0]
Sensitive Drug Imatinib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell viability Inhibition hsa05200
Wnt2-mediated Beta-catenin signaling pathway Inhibition hsa04310
In Vitro Model K562 cells Blood Homo sapiens (Human) CVCL_0004
Ku812 cells Bone marrow Homo sapiens (Human) CVCL_0379
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description microRNA-199a/b-5p enhance imatinib efficacy via repressing WNT2 signaling-mediated protective autophagy in imatinib-resistant chronic myeloid leukemia cells.
References
Ref 1 Epigenetic silencing of microRNA-199b-5p is associated with acquired chemoresistance via activation of JAG1-Notch1 signaling in ovarian cancer. Oncotarget. 2014 Feb 28;5(4):944-58. doi: 10.18632/oncotarget.1458.
Ref 2 microRNA-199a/b-5p enhance imatinib efficacy via repressing WNT2 signaling-mediated protective autophagy in imatinib-resistant chronic myeloid leukemia cells. Chem Biol Interact. 2018 Aug 1;291:144-151. doi: 10.1016/j.cbi.2018.06.006. Epub 2018 Jun 8.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.