Molecule Information

General Information of the Molecule (ID: Mol01578)

• Name: hsa-miR-182-5p ,Homo sapiens
• Synonyms: microRNA 182
• Molecule Type: Mature miRNA
• Sequence: UUUGGCAAUGGUAGAACUCACACU
• Ensembl ID: ENSG00000207990
• HGNC ID: HGNC:31553
• Mature Accession: MIMAT0000259

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Tamoxifen

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [1]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay; Colony formation assay
• Mechanism Description: Hsa_circ_0025202 suppressed BC progression and sensitized cells to TAM via sponging miR-182-5p, thereby attenuating its oncogenic effect.

References

• Ref 1: circRNA_0025202 Regulates Tamoxifen Sensitivity and Tumor Progression via Regulating the miR-182-5p/FOXO3a Axis in Breast Cancer. Mol Ther. 2019 Sep 4;27(9):1638-1652. doi: 10.1016/j.ymthe.2019.05.011. Epub 2019 May 17.