Molecule Information

General Information of the Molecule (ID: Mol01577)

• Name: hsa-miR-181c-5p ,Homo sapiens
• Synonyms: microRNA 181c
• Molecule Type: Mature miRNA
• Sequence: AACAUUCAACCUGUCGGUGAGU
• Ensembl ID: ENSG00000207613
• HGNC ID: HGNC:31552
• Mature Accession: MIMAT0000258

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic cancer [1]

• Sensitive Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Hippo signaling pathway; Inhibition; hsa04390
• In Vitro Model: SW1990 cells; Pancreas; Homo sapiens (Human); CVCL_1723
• In Vitro Model: 5-FU cells; Colon; Homo sapiens (Human); CVCL_1846
• In Vitro Model: PATU8988; Pancreas; Homo sapiens (Human); CVCL_1847
• In Vitro Model: PATU8988 cells; Pancreas; Homo sapiens (Human); CVCL_1846
• In Vitro Model: SW1990/GEM cells; Pancreas; Homo sapiens (Human); CVCL_ZW98
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Long non-coding RNA GAS5 antagonizes the chemoresistance of pancreatic cancer cells through down-regulation of miR181c-5p. GAS5 negatively regulated miR181c-5p, and miR181c-5p dramatically promoted pancreatic cancer cell chemoresistance through inactivating the Hippo signaling.

References

• Ref 1: Long non-coding RNA GAS5 antagonizes the chemoresistance of pancreatic cancer cells through down-regulation of miR-181c-5p. Biomed Pharmacother. 2018 Jan;97:809-817. doi: 10.1016/j.biopha.2017.10.157. Epub 2017 Nov 6.