Molecule Information

General Information of the Molecule (ID: Mol01573)

• Name: hsa-miR-10a-5p ,Homo sapiens
• Synonyms: microRNA 10a
• Molecule Type: Mature miRNA
• Sequence: UACCCUGUAGAUCCGAAUUUGUG
• Ensembl ID: ENSG00000284038
• HGNC ID: HGNC:31497
• Mature Accession: MIMAT0000253

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Pancreatic ductal adenocarcinoma [1]

• Resistant Disease: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• Cell Pathway Regulation: Epithelial mesenchymal transition signaling pathway; Activation; hsa01521
• In Vitro Model: BxPC-3 cells; Pancreas; Homo sapiens (Human); CVCL_0186
• In Vitro Model: MIA PaCa-2 cells; Pancreas; Homo sapiens (Human); CVCL_0428
• In Vitro Model: PANC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• In Vitro Model: AsPC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0152
• In Vitro Model: Su.86.86 cells; Pancreas; Homo sapiens (Human); CVCL_3881
• In Vitro Model: T3M4 cells; Pancreas; Homo sapiens (Human); CVCL_4056
• In Vivo Model: Nude mouse model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay; Transwell assay
• Mechanism Description: Transcription factor activating protein 2 gamma (TFAP2C) is a target of miR-10a-5p, and TFAP2C overexpression resensitizes PDAC cells to gemcitabine, which is initiated by miR-10a-5p.

References

• Ref 1: MiR-10a-5p targets TFAP2C to promote gemcitabine resistance in pancreatic ductal adenocarcinoma. J Exp Clin Cancer Res. 2018 Apr 3;37(1):76. doi: 10.1186/s13046-018-0739-x.