Molecule Information

General Information of the Molecule (ID: Mol01571)
Name
hsa-miR-139-5p ,Homo sapiens
Synonyms
microRNA 139
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UCUACAGUGCACGUGUCUCCAGU
    Click to Show/Hide
Ensembl ID
ENSG00000272036
HGNC ID
HGNC:31526
Mature Accession
MIMAT0000250
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
5 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [1], [2]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell viability Inhibition hsa05200
MAPK signaling pathway Inhibition hsa04010
c-Jun/BCL-xl signaling pathway Regulation hsa04210
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
A2780 cells Ovary Homo sapiens (Human) CVCL_0134
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qPCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometry assay
Mechanism Description Recovery of miR-139-5p suppressed the expression of c-Jun and thus reversed cisplatin-resistance in ovarian cancer. And miR-139-5p overexpression combined with inactivation of the MAPk signaling pathway can reverse the cisplatin resistance of OC by suppressing RNF2.
       Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Nasopharyngeal carcinoma [3]
Sensitive Disease Nasopharyngeal carcinoma [ICD-11: 2B6B.0]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell viability Inhibition hsa05200
In Vitro Model HNE1 cells Nasopharynx Homo sapiens (Human) CVCL_0308
Experiment for
Molecule Alteration		 qPCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometry assay
Mechanism Description The upregulation of miR-139-5p significantly increases DDP-induced apoptosis in NPC cells and modulates ZEB1 expression.
Docetaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [4]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Sensitive Drug Docetaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Notch signaling pathway Regulation hsa04330
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
In Vivo Model Mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 CCK8 assay; Flow cytometry assay; Transwell assay
Mechanism Description miR-139-5p inhibits the biological function of breast cancer cells by targeting Notch1 and mediates chemosensitivity to docetaxel.
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [5]
Resistant Disease Colorectal cancer [ICD-11: 2B91.1]
 Disease Info 
Resistant Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell metastasis Activation hsa05205
Cell proliferation Activation hsa05200
miR139-5p/Notch1 signaling pathway Regulation hsa05206
In Vitro Model HT29 Cells Colon Homo sapiens (Human) CVCL_A8EZ
SW480 cells Colon Homo sapiens (Human) CVCL_0546
SW620 cells Colon Homo sapiens (Human) CVCL_0547
HCT116 cells Colon Homo sapiens (Human) CVCL_0291
HEK293T cells Kidney Homo sapiens (Human) CVCL_0063
LOVO cells Colon Homo sapiens (Human) CVCL_0399
HCT8 cells Colon Homo sapiens (Human) CVCL_2478
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description Long non-coding RNA LINC00152 promotes cell proliferation, metastasis, and confers 5-FU resistance in colorectal cancer by inhibiting miR139-5p. LINC00152 could regulate the expression of NOTCH1 through sponging miR139-5p and inhibiting its activity from promoting CRC progression and development.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal carcinoma [6]
Sensitive Disease Colorectal carcinoma [ICD-11: 2B91.3]
 Disease Info 
Sensitive Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model HCT116 cells Colon Homo sapiens (Human) CVCL_0291
HCT8 cells Colon Homo sapiens (Human) CVCL_2478
In Vivo Model Mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay; Colony formation assay
Mechanism Description miR139-5p reverses CD44+/CD133+-associated multidrug resistance by downregulating NOTCH1 in colorectal carcinoma cells.
Disease Class: Colorectal cancer [7]
Sensitive Disease Colorectal cancer [ICD-11: 2B91.1]
 Disease Info 
Sensitive Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
IGF-1R/AKT/S6 signaling pathway Inhibition hsa05225
In Vitro Model HCT116 cells Colon Homo sapiens (Human) CVCL_0291
HCT-8 cells Colon Homo sapiens (Human) CVCL_2478
LOVO cells Colon Homo sapiens (Human) CVCL_0399
In Vivo Model Mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay; Transwell assay
Mechanism Description Ectopic expression of miR-139-5p sensitized CRC cells to 5-FU by increasing 5-FU-induced apoptosis. In addition, miR-139-5p inhibited the expression of the miR-139-5p target gene NOTCH-1 and its downstream molecules MRP-1 and BCL-2, two key MDR-associated genes. Furthermore, silencing NOTCH-1 expression promoted the chemotherapeutic effects of 5-FU, and up-regulation of NOTCH-1 abrogated miR-139-5p-mediated sensitization to 5-FU in LoVo and HCT-116 cells.
       Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Colorectal cancer [8]
Sensitive Disease Colorectal cancer [ICD-11: 2B91.1]
 Disease Info 
Sensitive Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation BCL2 signaling pathway Regulation hsa04210
Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
In Vitro Model SW480 cells Colon Homo sapiens (Human) CVCL_0546
SW620 cells Colon Homo sapiens (Human) CVCL_0547
HCT116 cells Colon Homo sapiens (Human) CVCL_0291
LOVO cells Colon Homo sapiens (Human) CVCL_0399
RkO cells Colon Homo sapiens (Human) CVCL_0504
HT-29 cells Colon Homo sapiens (Human) CVCL_0320
LS174T cells Colon Homo sapiens (Human) CVCL_1384
COLO205 cells Colon Homo sapiens (Human) CVCL_F402
In Vivo Model Mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay; Transwell assay
Mechanism Description BCL2 is a direct target of miR-139-5p in colorectal cancer cells and showed that the tumour suppressor activity of miR-139-5p is mediated by the modulation of BCL2 expression. BCL2 family proteins regulate and contribute to programmed cell death or apoptosis. The cell apoptosis results showed the induction of apoptotic cells contributed greatly to 5-Fu and OXA drug sensitivity, which was consistent with the multidrug resistance mechanisms. miR-139-5p is downregulated in colorectal cancer cells and tissues, and its inhibitory effects on cell migration, invasion, and drug sensitivity are mediated by the downregulation of its target BCL2.
Oxaliplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal carcinoma [6]
Sensitive Disease Colorectal carcinoma [ICD-11: 2B91.3]
 Disease Info 
Sensitive Drug Oxaliplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model HCT116 cells Colon Homo sapiens (Human) CVCL_0291
HCT8 cells Colon Homo sapiens (Human) CVCL_2478
In Vivo Model Mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay; Colony formation assay
Mechanism Description miR139-5p reverses CD44+/CD133+-associated multidrug resistance by downregulating NOTCH1 in colorectal carcinoma cells.
       Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Colorectal cancer [8]
Sensitive Disease Colorectal cancer [ICD-11: 2B91.1]
 Disease Info 
Sensitive Drug Oxaliplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation BCL2 signaling pathway Regulation hsa04210
Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
In Vitro Model SW480 cells Colon Homo sapiens (Human) CVCL_0546
SW620 cells Colon Homo sapiens (Human) CVCL_0547
HCT116 cells Colon Homo sapiens (Human) CVCL_0291
LOVO cells Colon Homo sapiens (Human) CVCL_0399
RkO cells Colon Homo sapiens (Human) CVCL_0504
HT-29 cells Colon Homo sapiens (Human) CVCL_0320
LS174T cells Colon Homo sapiens (Human) CVCL_1384
COLO205 cells Colon Homo sapiens (Human) CVCL_F402
In Vivo Model Mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay; Transwell assay
Mechanism Description BCL2 is a direct target of miR-139-5p in colorectal cancer cells and showed that the tumour suppressor activity of miR-139-5p is mediated by the modulation of BCL2 expression. BCL2 family proteins regulate and contribute to programmed cell death or apoptosis. The cell apoptosis results showed the induction of apoptotic cells contributed greatly to 5-Fu and OXA drug sensitivity, which was consistent with the multidrug resistance mechanisms. miR-139-5p is downregulated in colorectal cancer cells and tissues, and its inhibitory effects on cell migration, invasion, and drug sensitivity are mediated by the downregulation of its target BCL2.
Vincristine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal carcinoma [6]
Sensitive Disease Colorectal carcinoma [ICD-11: 2B91.3]
 Disease Info 
Sensitive Drug Vincristine
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model HCT116 cells Colon Homo sapiens (Human) CVCL_0291
HCT8 cells Colon Homo sapiens (Human) CVCL_2478
In Vivo Model Mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay; Colony formation assay
Mechanism Description miR139-5p reverses CD44+/CD133+-associated multidrug resistance by downregulating NOTCH1 in colorectal carcinoma cells.
References
Ref 1 Reversal of cisplatin resistance by microRNA-139-5p-independent RNF2 downregulation and MAPK inhibition in ovarian cancer. Am J Physiol Cell Physiol. 2018 Aug 1;315(2):C225-C235. doi: 10.1152/ajpcell.00283.2017. Epub 2018 May 2.
Ref 2 Recovery of miR-139-5p in Ovarian Cancer Reverses Cisplatin Resistance by Targeting C-Jun. Cell Physiol Biochem. 2018;51(1):129-141. doi: 10.1159/000495169. Epub 2018 Nov 15.
Ref 3 MicroRNA-139-5p affects cisplatin sensitivity in human nasopharyngeal carcinoma cells by regulating the epithelial-to-mesenchymal transition. Gene. 2018 Apr 30;652:48-58. doi: 10.1016/j.gene.2018.02.003. Epub 2018 Feb 8.
Ref 4 MiR-139-5p inhibits the biological function of breast cancer cells by targeting Notch1 and mediates chemosensitivity to docetaxel. Biochem Biophys Res Commun. 2015 Oct 2;465(4):702-13. doi: 10.1016/j.bbrc.2015.08.053. Epub 2015 Aug 20.
Ref 5 Long non-coding RNA LINC00152 promotes cell proliferation, metastasis, and confers 5-FU resistance in colorectal cancer by inhibiting miR-139-5p. Oncogenesis. 2017 Nov 28;6(11):395. doi: 10.1038/s41389-017-0008-4.
Ref 6 MiR-139-5p reverses CD44+/CD133+-associated multidrug resistance by downregulating NOTCH1 in colorectal carcinoma cells. Oncotarget. 2016 Nov 15;7(46):75118-75129. doi: 10.18632/oncotarget.12611.
Ref 7 miR-139-5p sensitizes colorectal cancer cells to 5-fluorouracil by targeting NOTCH-1. Pathol Res Pract. 2016 Jul;212(7):643-9. doi: 10.1016/j.prp.2016.04.011. Epub 2016 May 3.
Ref 8 miR-139-5p Inhibits the Epithelial-Mesenchymal Transition and Enhances the Chemotherapeutic Sensitivity of Colorectal Cancer Cells by Downregulating BCL2. Sci Rep. 2016 May 31;6:27157. doi: 10.1038/srep27157.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.