Molecule Information

General Information of the Molecule (ID: Mol01565)

• Name: hsa-miR-198 ,Homo sapiens
• Synonyms: microRNA 198
• Molecule Type: Mature miRNA
• Sequence: GGUCCAGAGGGGAGAUAGGUUC
• Ensembl ID: ENSG00000284121
• HGNC ID: HGNC:31570
• Mature Accession: MIMAT0000228

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [1]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Activation; hsa04151
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: BGC823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR; Dual-luciferase reporter assay
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Circular RNA AkT3 upregulates PIk3R1 to enhance cisplatin resistance in gastric cancer via miR-198 suppression.

Temozolomide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioblastoma [2]

• Sensitive Disease: Glioblastoma [ICD-11: 2A00.02]
• Sensitive Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• In Vitro Model: LN229 cells; Brain; Homo sapiens (Human); CVCL_0393
• In Vitro Model: A172 cells; Brain; Homo sapiens (Human); CVCL_0131
• In Vitro Model: T98 cells; Brain; Homo sapiens (Human); CVCL_B368
• In Vitro Model: U87 cells; Brain; Homo sapiens (Human); CVCL_0022
• In Vitro Model: U118 cells; Brain; Homo sapiens (Human); CVCL_0633
• In Vitro Model: U138 cells; Brain; Homo sapiens (Human); CVCL_0020
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Colony formation assay
• Mechanism Description: miR-198 enhances temozolomide sensitivity in glioblastoma by targeting MGMT.

References

• Ref 1: Circular RNA AKT3 upregulates PIK3R1 to enhance cisplatin resistance in gastric cancer via miR-198 suppression. Mol Cancer. 2019 Mar 30;18(1):71. doi: 10.1186/s12943-019-0969-3.
• Ref 2: MiR-198 enhances temozolomide sensitivity in glioblastoma by targeting MGMT. J Neurooncol. 2017 May;133(1):59-68. doi: 10.1007/s11060-017-2425-9. Epub 2017 Apr 19.